1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aivan3 [116]
3 years ago
13

What are the implications for everyone if we dont have antibiotics to treat infections?

Biology
1 answer:
baherus [9]3 years ago
4 0

we would loose the capability of curing every simple sickness that antibiotics can cure and will eventually die from sickness and disease

You might be interested in
An adolescent presents to a community clinic for treatment of vulvar lesions associated with type 2 herpes simplex. which interv
sveticcg [70]
Herpes simplex, type 2 is typically the strain associated with genital herpes. A symptomatic patient with herpes may describe vulvar lesions causing pain with sitting. When lesions are visible, herpes is characterized by multiple, painful vesicles and/or ulcerated lesions. Herpes lesions are typically much smaller than the described single mass.

<span>Lichen sclerosis is a chronic, progressive dermatological problem; it often involves the vulvar and perineal epithelium. It is characterized by pruritus, dyspareunia, and fissuring of the skin. Lichen sclerosis is more common in post-menopausal women, and physical exam reveals thin, white-appearing tissue. Masses are not associated with lichen sclerosis.</span>
4 0
3 years ago
In animals which process produces atp molecules
Firdavs [7]
Protein synthesis in the ribosomes
3 0
3 years ago
Imagine the grasshoppers population was gone. What would happen to the black and white bird population?​
Zina [86]

Answer:

The black and yellow bird population would begin to starve and would be forced to find alternative food, or die off. This would then send ripples through the food web, causing almost every species to be effected by the grasshoppers being gone.

4 0
3 years ago
Is balamuthia mandrillaris a public health concern worldwide?
True [87]
Balamuthia mandrillaris is an amoeba that was discovered in 1986 in the brain of the baboon that dies in San Diego Wild Animal Park. This can be found in the soil and water, therefore it is freely living. It is known to cause the neurological condition known as granulomatous amoebic encephalitis. In a study published by National Center for Biotechnology Information, it has a case fatality rate of >98%. Majority of this case can be found in warmer regions that affects individuals mostly of Hispanic origin. Documented cases had been reported from the Latin Americas in significant number, followed by the United States, Asian regions and some in Europe. However, a specific number of cases worldwide may never be known due to the following factors: lack of awareness, poor diagnosis and a poor public health system.

It is still yet to be known if its a serious public health concern worldwide.

7 0
3 years ago
Dr. mclear is a scientist studying heredity. she wants to isolate the basic unit for the transmission of heredity, which is a(n)
AlekseyPX
I believe the answer would be gene.
5 0
3 years ago
Other questions:
  • How many different shapes of bacteria are there?<br> 1 shape<br> 2 shapes<br> 3 shapes<br> 4 shapes
    9·2 answers
  • The _____ is a pair of seahorse-shaped structures in the brain that play a central role in memory.
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Which term is defined as the change in physical state from liquid to gas at the surface of a liquid
    12·1 answer
  • Screaming into a pillow would be reflection, refraction, or absorption
    10·2 answers
  • During DNA replication, two extra guanine bases are added to the DNA. What type of mutation is this? A. Nondisjunction mutation
    7·1 answer
  • What is the name of the lateral leg bone
    9·1 answer
  • Most mammals have diploid body cells and haploid gametes. During __________, chromosomes from haploid gametes combine, and a ___
    10·1 answer
  • What are the three parts of an atoms
    6·1 answer
  • A heterozygous male Komodo dragon mates with a heterozygous female.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!