The t<u>unica media</u> is composed of an endothelial layer that is continuous with the endocardium of the heart.
<h3>What is tunica media?</h3>
Collagen, elastin, and smooth muscle cells make up tunica media. It is located halfway between the tunica externa and the tunica intima. The transverse arrangement of its strands and color make the middle coat (tunica medium) distinct from the inner (tunica intima). It not only supports the vessel but also alters the vessel's width to control blood pressure and flow.
Elastic fibers make up the majority of the tunica media in bigger vessels. The number of elastic fibers reduces as arteries get smaller, whereas the number of smooth muscle fibers grows. The strongest of the three layers is the tunica adventitia, which is the top layer. Elastic and collagenous fibers make up its structure.
Learn more about tunica media here:
brainly.com/question/15395381
#SPJ4
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
Answer:
C.) Experimental
Explanation:
He conducts test to see which shoe helps him better, in so doing a experimental investigation
Answer:
Firstly:
Where do talbots sympathies lie?
Answer:
Talbot didn't provide clear and direct answer
Secondly:
does she believe that naming a single valedictorian is right or wrong?
Answer:
Talbot gave her view on either sides which are "designed for a simpler time" and "something is lost if schools eliminate"
