1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zigmanuir [339]
2 years ago
14

How is cellular respiration related to metabolism?.

Biology
1 answer:
nekit [7.7K]2 years ago
5 0

Answer:

Cellular respiration is a set of metabolic reactions and processes that take place in the cells of organisms to convert chemical energy from oxygen molecules or nutrients into adenosine triphosphate (ATP), and then release waste products.

Request: Please mark me as the brainliest.

You might be interested in
Compare and contrast quantitative and descriptive research
Eva8 [605]

Answer:

Qualitative research seeks to understand why people react and how they feel about a specific situation. Quantitative research measures numerical results to help predict possible outcomes. In other words, qualitative research is concerned with "why," whereas quantitative research is concerned with "what."

Explanation:

7 0
3 years ago
Gigantic mammals (mammoths, giant sloths, etc.) characterize these times.
nignag [31]
The answer is a. Pleistocene.

A group of large animals that lived during the Pleistocene is called Pleistocene megafauna. This group included mammoths, giant sloths, mastodons, cave bears, saber-toothed cats, etc. The extinction of these animals happened also in Pleistocene. The reasons for their extinction could be hunting by the humans, climate changes, or impact of asteroides.
6 0
3 years ago
1. By examining the fin of a primitive fish, scientists
mr Goodwill [35]
They might have a common ancestor.
8 0
3 years ago
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
PLEASE HELP!!! <br><br> Atomic number is the same as number of ______.
NISA [10]
The protons in the nucleus
7 0
3 years ago
Read 2 more answers
Other questions:
  • True or False Kelp are multicellular organisms that live in the ocean.
    8·2 answers
  • What happens during photosynthesis?
    12·2 answers
  • Why is skaneateles not affected by acid rain as much as we may think it would be ?
    15·1 answer
  • Which of the following is single-stranded, found throughout the cell, and has the bases A, C, U, and G?
    11·1 answer
  • Fluorescent dyes can be added to groundwater in order to trace the waters path. A researcher placed some fluorescent dye into a
    15·2 answers
  • How does hydrogen cycle through the environment and organisms?
    8·1 answer
  • Your body recognizing your getting hot and then sweating to help cool off and maintain a constant temperature is an example of w
    7·1 answer
  • *100 POINTS* | No Links, thank you in advance for your help.
    11·2 answers
  • Which of the following cell types is diploid?
    11·2 answers
  • Cheetah have evolved a much higher lung capacity,why
    13·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!