1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bess [88]
3 years ago
15

How do accessory organs such as the liver and gallbladder help with digestion if they do not come into direct contact with the f

ood we eat?
Biology
1 answer:
enyata [817]3 years ago
5 0

Answer:

they just help us break down the food and then procces the food to the other organs

Explanation:

You might be interested in
During which eon did oxygen begin to build up the most in Earth’s atmosphere?
goldenfox [79]

Answer: Proterozoic

Explanation:

3 0
3 years ago
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
PLEASE ANSWER THE MIDDLE 2 ROWS. 13 points
Blizzard [7]
Low tide:
When on the opposite side of the Earth that where the Sun is located
High tide: moons gravitational force pulls on water in the ocean so. That there bulges in the ocean on both sides of the planet
7 0
3 years ago
In a series of experiments, Avery treated heat-killed nonvirulent s bacteria with enzymes that degraded the proteins, dna, and r
Pavlova-9 [17]

Answer:

<u><em>C. DNA from the S bacteria is necessary for bacterial transformation to occur.</em></u>

Explanation:

These series of experiments determined that DNA is the genetic material which gives rise to a particular type of cell. As we can see, the S bacteria with degraded proteins were able to grow when the proteins and RNA were degraded. But they were not able to grow when their DNA was degraded. This experiment proved that proteins or RNA are not the genetic material, rather DNA is the material related to inheritance.

7 0
4 years ago
Where do many of the world's deserts lie?
Jlenok [28]

Answer:

Most of the world's deserts are located near 30 degrees north latitude and 30 degrees south latitude, where the heated equatorial air begins to descend

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • In regards to the Amoeba  Sisters' video about blood type, if a man with Type A blood and a woman with Type O blood have a child
    10·1 answer
  • A star has a mass fifty times greater than Earth's sun, very high teperature, and is very bright. What will most likely happen t
    12·2 answers
  • Because of hemoglobin, blood is able to carry ____ times more oxygen than what can dissolve in the blood.​
    11·1 answer
  • Many countries, including the United States, measure output by calculating the _____.
    9·1 answer
  • Antonym for Food Chain?
    8·2 answers
  • The presence of chloroplasts in cells would place an organism into which of the following kingdoms
    7·1 answer
  • Help don’t know the answer
    7·1 answer
  • If the gametes produced by a given organism contain 6 chromosomes, how many chromosomes are found in that organism’s body cells?
    14·1 answer
  • Examine the image for a step in meiosis shown here. What is the significance of the arrangement of homologous chromosomes shown
    6·1 answer
  • In the small intestine the products of digestion are absorbed by both diffusion and... what?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!