1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ikadub [295]
3 years ago
9

2.) What is transported in the xylem and the phloem?

Biology
2 answers:
Murrr4er [49]3 years ago
6 0
Xylem tissue is used mostly for transporting water from roots to stems and leaves but also transports other dissolved compounds. Phloem is responsible for transporting food produced from photosynthesis from leaves to non-photosynthesizing parts of a plant such as roots and stems.
adell [148]3 years ago
5 0

Answer:

Xylem transfers water up from the roots to the leaves.

Phloem transfers sugars (glucose) produced in the leaves down to the roots to be stored.

You might be interested in
How certain do you feel that the theory of plate tectonics is correct? What evidence would you use to support your opinion?
nika2105 [10]

Answer: I feel that the theory of plate tectonics is correct, because we use friction every day which means friction could make vibrations larger too!

4 0
3 years ago
Read 2 more answers
Please HELP!!!!!!!
Usimov [2.4K]

Answer:

C

Explanation:

Glucose is with engergy.  Oxygen would be the food.  Amino Acid helps with healing the cells.  

8 0
3 years ago
Shortening a muscle while it maintains constant tension is called ________
Tasya [4]
Hey mate
----------------------------------------------------------------------
Shortening a muscle while it maintains constant tension is called •an isotonic contraction.
----------------------------------------------------------------------
I hope this answer will satisfy your requirement ........
;-)
6 0
3 years ago
List three major marine ecological zones
Temka [501]
1. open ocean 
2. inter tidal zone
3. coastal zone

7 0
4 years ago
Read 2 more answers
What does NBT stand for?✨​
Liono4ka [1.6K]
Nothing but trouble?
4 0
3 years ago
Other questions:
  • An experimenter wanted to test the effects of cigarette smoking on rats. She infused the cages of 50 rats with cigarette smoke a
    10·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following occurs in situations where more than one hormone produces the same effects at the target cell and their c
    15·1 answer
  • Which structure is not unique to plant cells? chloroplast central vacuole cell wall nucleus
    13·2 answers
  • What defines the kingdom Protista?​
    8·1 answer
  • Which off the cells shown are diploid
    7·2 answers
  • Red-green color blindness is due to an X-linked recessive allele in humans. A widowâs peak (a hairline that comes to a peak in t
    10·1 answer
  • The answer is D!!! What was the purpose of Miller and Urey's experiment?
    12·1 answer
  • What are day and night?<br> PLS ANSWER WILL GIVE BRAINLIEST
    6·2 answers
  • Emotional response of teenage girls​
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!