1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ch4aika [34]
2 years ago
11

The diagram below shows four coastline locations on Earth with respect to the moon at a given time.

Biology
2 answers:
Alinara [238K]2 years ago
7 0

Answer: not sure sirry

Explanation:

doing this to not get ads

Viktor [21]2 years ago
7 0

Answer:

Both B and D i believe

Explanation:

You might be interested in
When wearing your seatbelt it should fit ____ and ___ across your waist and across the chest diagonally?
RSB [31]
<span>A seatbelt should be fastened so as to run diagonally across the chest and to fit low and tight across the waist. This ensures that, during the rapid deceleration experienced during a crash, the seatbelt will perform the intended function, that is, to keep the passenger in place within the vehicle.</span>
5 0
3 years ago
Read 2 more answers
Can some one plz help me I’m confused on what to do
luda_lava [24]

Answer:

the questions are asking you like what is the carrying capacity for the rabbits and etc.So you take the information from the graph and answer the questions with the information that it is giving you from the graph. I hope this answers your question.

5 0
3 years ago
In what way do two alleles for the same trait differ?
kvasek [131]
I think it’s C explanation : i learned this a while ago
8 0
3 years ago
How does the water get from the air to the ground
loris [4]
It forms in the clouds which causes rain and then falls to the ground thus causing a wet ground
7 0
3 years ago
Read 2 more answers
The layer of the skin that contains bundles of collagen and elastic fibers responsible for the strength of the skin is the _____
Lesechka [4]
Dermis connective tissue layer
5 0
3 years ago
Other questions:
  • During dna replication the original strand (attcgcgattta) was replicated as (attcggattta). what type of mutation has is present?
    13·2 answers
  • Which of the listed relationships between groups is correct?
    12·1 answer
  • If you were to create a planet capable of supporting life forms similar to those on earth, the necessary elements to include wou
    12·1 answer
  • These cells are part of the domains Archaea and Bacteria. prokaryotes eukaryotes
    5·2 answers
  • Will turtles become extinct
    5·2 answers
  • The European buckthorn was introduced to North America as an ornamental plant. However, this plant is now a major threat to many
    7·1 answer
  • Can someone help me pls
    12·2 answers
  • Which organism below receives 10% of the available energy?
    9·1 answer
  • In aerobic respiration, electron transport is the final step in the breakdown of glucose. In the end, what does the electron tra
    10·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!