1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bond [772]
3 years ago
15

Hydrogen fusion occurs in the _____ of the Sun.

Biology
2 answers:
pashok25 [27]3 years ago
4 0

Answer: core

Explanation:  Nuclear fusion is a reaction in which two or more than two nuclei fuse together to form a larger and stable nuclei.

Thus in order to bring two nuclei close, it requires a lot of energy to overcome repulsive forces between them. This can be achieved by supplying large amount of energy and this is present in the core of the sun which is at high temperatures.

The other parts of sun called photosphere, corona, radiative zone, chromosphere and conductive zone have relatively low temperatures and thus fusion cannot take place here.

_1^2\textrm{H}+_1^3\textrm{H}\rightarrow _2^4\textrm{He}+_{0}^1\textrm{n}

fgiga [73]3 years ago
3 0
The core, since it is the only area hot enough to do so.
You might be interested in
My daughter needs help with science can someone help her?
Arisa [49]
<span>#1) Which of the following is an example of a trend?

Answer: Out of all the options that are available the one that represents an example of a trend in science is the gradual warming of earth's atmosphere over time. The reason being that a trends is the most results that are presented going towards one direction opposed to another.

#2) The fact that the sun rises and sets at different times during the day depending on the time of year is an example of a data trend.

Answer: The statement presented above is false. The best way to represent a data trend is to look at the chart and look at the data points and see how they connect. The best question to use when identifying a trends is Why is it happening. A trend is often found when data consistently increases or decreases in response to a variable.

#3) Predictable amounts of rainfall in each of the 4 seasons is an example of a pattern.

Answer: The statement shown above is absolutely true. Because as stated in the statement it is predictable.

#4) A trend exists when data shows consistent regular repetitive form.

Answer: This statement is False. As previously explained a trend is when data consistently increases or decreases in response to a variable. A pattern is when data shows consistent, regular, and repetitive form.

#5) What will happen to the number of airplanes that fly over the pond as the amount of pollution increases?

Answer: Since the amount of pollution in the pond and the number of planes that fly by are not related the number of airplanes that fly over the pond will stay the same or will respond randomly.

#6) This is an example of what type of relationships?

Answer: According to the scenario that is presented above this would be a direct type of relationship since the number of rabbits in a community goes up the number of foxes in the same community also goes up.

#7) What kind of relationship do the shade of red and the chemicals in the tree have?

Answer:
This case would also be a direct type of relationship, because as the chemicals in the tree increases, the leaves of a tree turn a deeper shade of red.

<span>I hope it helps, Regards.</span></span>
3 0
3 years ago
How do the locations of earthquakes and volcanoes compare?
Kryger [21]
The locations of earthquakes and volcanoes are often close together given the fact that they are both the result of the earths tectonic plates shifting.   
5 0
3 years ago
What produce energy from food during respiration​
BlackZzzverrR [31]

Answer:

The cellular process of releasing energy from food through a series of enzyme-controlled reactions is called respiration. Some of the energy released is used to produce ATP. Some of the energy released is lost as heat.

5 0
3 years ago
Consider a cell that requires much more ribose5‑phosphate than NADPH. The cell needs ribose 5‑phosphate but has a relatively hig
Sergio039 [100]

Answer:

The fate of glucose-6-phosphate,glycolytic intermediates and pentose phosphate pathways are described below

Explanation:

Fate of Glucose -6-phosphate

Glucose-6-phosphate undergo dephosphorylation to form glucose when there is an increase demand of glucose in the body.

Glucose-6-phosphate enters into pentose phosphate pathway to synthesize ribose-5-phosphate which is used during denovo pathway of purine nucleotide biosynthesis.

Fate of glycolytic intermediates

Glyceraldehyde-3-phosphate is an important intermediate of glycolysis.The glyceraldehyde-3-phosphate act as a precursor during lipogenesis that deals with the biosynthesis of triacylglycerol.

Fate of pentose phosphate pathway intermediates

Ribose-5-phosphate and NADPH are the important intermediates of pentone phosphate pathway.

 Ribose-5-phosphate act as a substrate molecule during the denovo biosynthesis pathway of purine nucleotides.

NADPH act as a reducing agent during fatty acid biosynthesis process.

4 0
3 years ago
Through ___ Larger molecules are formed .
eimsori [14]
Through the larger molecules are formed
3 0
3 years ago
Other questions:
  • How do scientist uses seismic waves to know these earmuffs are located in the mantle
    15·1 answer
  • A young woman was brought into the emergency room because of repeated seizures. her roommate said that the woman had taken the d
    14·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has
    15·1 answer
  • Important advantages to raised-bed gardens are that they
    7·1 answer
  • A controlled experiment is one that_______________.
    12·1 answer
  • In which cycle does the virus to remain dormant?
    8·2 answers
  • Which is an example of the beneficial application of plants in human society
    15·2 answers
  • The diameter of the........... is so thin that only one red blood cell can get through at a time.
    10·2 answers
  • These protein-based substances enhance digestion by making chemical reactions more likely to happen. group of answer choices bil
    12·1 answer
  • A large forest fire burns in Canada, dropping black carbon on Greenland. Which of the following is true
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!