1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Daniel [21]
3 years ago
7

ATP is made of ribose, adenine, and _____.

Biology
1 answer:
olga_2 [115]3 years ago
6 0
 (ATP) is comprised of an adenine ring, a ribose sugar, and three phosphate groups.
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
A research study looked at variations in snail populations in urban areas compared to natural ecosystems outside of the urban de
GaryK [48]

Answer:

D

Explanation:

I just got it right

5 0
3 years ago
After Paul's serious snow-skiing accident, doctors detected damage to his cerebral cortex in Wernicke's area. Because of the dam
Leokris [45]

Answer: Difficulty with communication

Explanation: The cerebral cortex is the thin layer of the brain that covers the outer portion (1.6mm to 5mm) of the cerebrum. It is covered by the meninges and often referred to as gray thing . The cortex is gray because nerves in this area lack the insulation that makes most other parts of the brain appear to be white. The cortex also covers the cerebellum.

The cerebellum receives information from the sensory systems, the spinal cord, and other parts of the brain and then regulates motor movements. The cerebellum coordinates voluntary movements such as posture, balance, coordination, and <em><u>speech</u></em>, resulting in smooth and balanced muscular activity

Brainly pls Hope this helps :)

3 0
2 years ago
To which of the same groups do the raccoon and the guinea pig belong
Svetllana [295]
The guinea pig and the raccoon are both members of :
The eukarya domain, the kingdom of animals, the chordates and the mammal class.
After the level of class (Mammalia), they start to belong to different groups.
The guinea pig belongs to rodents and the raccoon belongs to the carnivores.
5 0
3 years ago
The thylakoids of chloroplasts are the location of several important steps of photosynthesis. Suppose you put chloroplasts in th
Savatey [412]
The answer is A I think
7 0
2 years ago
Other questions:
  • Are corpse flowers vascular or non vascular?
    5·1 answer
  • What happens during cytokinesis? (1 point).
    11·1 answer
  • Homology and homoplasy produce similar traits. What is the key difference?
    15·1 answer
  • PLEASE ANSWER.   E. coli is a species of bacteria that causes many different infections in humans. Certain E. coli strains have
    7·2 answers
  • Which of the following particles has no charge?
    13·2 answers
  • What type of celestial object is the Sun?
    12·1 answer
  • You mature gradually, but do some things, like graduate from high school, at once. This difference is an example of:
    11·1 answer
  • 4. removes excess water, salts, uric acids, and chemicals from the blood pulmonary circulation
    9·1 answer
  • What is the relationship between the rate of wind and the amount of abrasion?
    9·1 answer
  • What is unique about the life cycle of angiosperm ?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!