Answer:
25%
Explanation:
Here's an example: two chickens have the phenotype of white feathers and brown feathers. What percentage of the chicks will have the recessive color? First, you have to see the parents' phenotypes. Draw a punnet square. Put one of the parent's phenotypes (w and B) on the top, and the other parent's (w and B) on the right side going down. Whichever trait is dominant (brown) MUST be capitalized. Then, cross the two parents. first box on the top left would read 'ww.' The one below it is 'Bw' (put the dominant first). The right top is 'Bw' and the one below it is 'BB'. So if there were 4 offspring, these would be their genotypes: 'ww', 'Bw', 'Bw', and 'BB'. The only offspring that would have the recessive trait is the 'ww' child, because dominant overpowers recessive. So 25% would have the recessive trait and 75% would have the dominant trait.
Q1)
the sequence given, we need to read from 5' to 3' and find where the reading frame starts. That's where atg is found.
<span>5’ agcggg atg agcgcatgtggcgcataactg3’
from here onwards we have to separate the bases into groups of three as these are codons that each code for an amino acid.
</span><span>5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
TAA(UAA in mRNA ) is the stop codon so reading frame stops here
we change base A to T (capitalised)
DNA sequence with amino acids are given
</span>5’ agcggg atg Tgc gca tgt ggc gca taa ctg 3’
N Met Cys Ala Cys Gly Ala stop
after changing the base the amino acid sequence changes from Ser to Cys.
Q2)
the complementary strand of the above strand is as follows <span>
5' cagttatgcgccacatgcgctcatcccgct 3'
start codon starts with atg thats where the reading frame starts
</span>5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
After changing base from A to T, the complementary strand changes from T to A (capitalised)
5' cagtt atg cgc cac atg cgc Aca tcc cgc t 3'
Met Arg His Met Arg Thr Ser Arg
amino acid changes from Ser to Thr.
Q3)
The sequence with amino acids before inserting a base is
5’ agcggg atg agc gca tgt ggc gca taa ctg 3’
Met Ser Ala Cys Gly Ala stop
We insert a base G shown in capitals
5’ agcggg atg agc Ggca tgt ggc gca taa ctg 3’
This changes the codons of bases after the inserted base
5’ agcggg atg agc ggc atg tgg cgc ata act g 3’
Met Ser Gly Met Trp Arg Ile Thr
the amino acid completely changes from Met Ser Ala Cys Gly Ala
to Met Ser Gly Met Trp Arg Ile Thr
Q4)
the complementary strand before adding a base is
5' cagtt atg cgc cac atg cgc tca tcc cgc t 3'
Met Arg His Met Arg Ser Ser Arg
When we insert a base G, base C is added to the complementary strand
5' cagtt atg cgc cac atg cCgc tca tcc cgc t 3'
this changes the codons
5' cagtt atg cgc cac atg cCg ctc atc ccg ct 3'
Met Arg His Met Pro Leu Ile Pro
With insertion of one base the amino acid sequence changes from
Met Arg His Met Arg Ser Ser Arg
to Met Arg His Met Pro Leu Ile Pro
The preferred prey item would be frogs.
What is optimal foraging theory?
It is a theory in ecology that proposes that predating animals that get the most energy from minimal efforts are favored by natural selection.
In order words, selection forces prefer investing minimum energy in order to extract maximally available energy.
In this case, the heron needs to use the lowest time to harvest the maximum energy possible. Since all the preys offer the same amount of energy, the one that requires the lowest time would be preferable for the heron.
In other words, frogs would be the most preferable prey.
More on foraging theory can be found here: brainly.com/question/16970714
#SPJ12
Answer:
True
Explanation:
Eukaryotic chromosomes are larger than that of prokaryotes. Prokaryotic chromosome contains a covalently closed circular DNA. Each eukaryotic chromosome contains a linear DNA with two ends. So this fact would be true.
Hope this helps :D have a great day :3
<h2>Answer:</h2>
The one condition that must be met for a population to be in genetic equilibrium:
A Large Breeding Population.
<h3>Explanation:</h3>
- A large breeding population helps to ensure that chance alone does not disrupt genetic equilibrium.
- In a small population, only a few copies of a certain allele may exist.
- If for some chance reason the organisms with that allele do not reproduce successfully, the allelic frequency will change.
