1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WITCHER [35]
3 years ago
6

Use the information in the slide show and the textbook pages

Biology
1 answer:
DedPeter [7]3 years ago
3 0
Take a picture of the text book , so I can find the answer
You might be interested in
100 POINTS!!! ANSWER ASAP [5 SENTENCE ANSWER] Explain the relationship among distance, mass and gravitational force between any
Karolina [17]
Since the gravitational force is directly proportional to the mass of both interacting objects, more massive objects will attract each other with a greater gravitational force. So as the mass of either object increases, the force of gravitational attraction between them also increases. If the mass of one of the objects is doubled, then the force of gravity between them is doubled. If the mass of one of the objects is tripled, then the force of gravity between them is tripled. If the mass of both of the objects is doubled, then the force of gravity between them is quadrupled; and so on.

Hope this helps.
4 0
3 years ago
Read 2 more answers
What is the largest organ in your body?
slavikrds [6]

Answer:

On the inside of your body would be the Liver, overall would be the skin.

Explanation:

Look at scale images or medical diagrams and you will see.

please mark brainliest

8 0
2 years ago
What evidence is there that the endangered species act is causing harm to species????
Juliette [100K]

Answer:

There is strong and increasing evidence the Endangered Species Act is causing widespread harm to the species it is supposed to protect-to the extent the Act may be doing more harm than good. The Act makes otherwise normal and legal forms of land and resource use illegal, such as farming, home building and cutting timber. The Endangered Species Act’s severe penalties-$100,000 and/or 1 year in jail for harming a single species or even unoccupied habitat that is deemed suitable-turn species in to liabilities. As a result, landowners seek to reduce their liabilities in a number of ways.

Explanation:

3 0
3 years ago
Help Me on this Science ? Its Really Confusing and i need it to get a passing grade
Crank
I'll help you with your science
7 0
3 years ago
What two environmental factors influence the shape of a proteins?
marysya [2.9K]
It’s d I took test yesterday got 1000
4 0
3 years ago
Other questions:
  • Which of the following is an example of an endothermic process?
    6·1 answer
  • What question is testable
    5·2 answers
  • What are some advantages of breeding strategies
    10·1 answer
  • An occluded front moves over farmland that has been experiencing drought conditions. What change in weather will this front like
    7·2 answers
  • Martha has a widow's peak (dominant trait) and attached earlobes (recessive trait). Martha's dad had a straight hairline and una
    15·1 answer
  • With regard to cognitive development, piaget argued that _____ is more revealing than _____.
    15·1 answer
  • Suppose you examined a pedigree of a large family, going back 6 generations. In generation 5, a woman ("G5W") has a serious gene
    14·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Alloon 1 and Balloon 2 are filled with the same amount of air.
    13·2 answers
  • What are different examples of lipids? 1. DNA, RNA, ATP 2.monosaccahrides, starch, cellulose 3.triglycerides, waxes, steroids, p
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!