1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alex41 [277]
3 years ago
13

Which is the correct answer?.

Biology
2 answers:
gtnhenbr [62]3 years ago
5 0

Answer:

d. 232 km/h

Explanation:

speed = distance/ time

speed = 290/1.25

speed = 232 km/h

Mama L [17]3 years ago
5 0

Answer:

d

Explanation:

You might be interested in
How is a whale more like a human than a fish? CHOOSE ALL THAT APPLY 1.warm blooded 2.breast feeds its young 3.spends much time o
HACTEHA [7]

Answer:

1. warm blooded, 2. breast feed its young

Explanation:

Whales are warm blooded, which means they keep a high body temperature that does not change in the cold water. Fish are cold-blooded, so their body temperature changes depending on the temperature of their environment. AND hales are other mammals that feed their young milk too, although it takes plenty more to feed them than human babies

7 0
2 years ago
When conducting legal experiments on animals a researcher needs to obtain consent from the?
Alenkasestr [34]
When conducting legal experiments on animals, a researcher needs to obtain consent from the INSTITUTIONAL RESEARCH BOARD.
Each research institution has research board which sees into uses of animals for research purposes, consent must be obtained from the board before experiments involving usage of animals is carried out.

7 0
3 years ago
The nervous system works closely with which of the following organ
Artyom0805 [142]
A because I know it because I have the same test and it was right
4 0
3 years ago
Read 2 more answers
Which of the following is a primary function of the active site of an enzyme?
Fiesta28 [93]

The primary function of the active site of an enzyme is to catalyze the reaction associated with the enzyme (Option c). It is a fundamental structure in the enzyme.

<h3>What is the active site of an enzyme?</h3>

The active site of the enzyme is It is a fundamental structure in the enzyme that has catalytic activity.

The active site of the enzyme is a site that binds to the substrate to form the enzyme-substrate complex.

The formation of this complex leads to the generation of one or more products of a given chemical reaction.

Learn more about enzymes here:

brainly.com/question/1596855

3 0
2 years ago
PLEASE HELP DUE VERY SOOONNNN PLEASEEE HELPPP
FrozenT [24]

Answer:

how can I help u with.

I can't see any pictures

u post a question picture.

I can answer u

7 0
3 years ago
Other questions:
  • Which is the genotype of the unknown offspring on row two of the Punnett square above?
    11·1 answer
  • Why are the trans-fatty acids common in fast foods a concern to nutritionists?
    15·1 answer
  • An image is 50mm across. It started of 1.25mm across. How many times has it been magnified?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • What is the magnification of an electron microscope?
    15·2 answers
  • Knees
    10·1 answer
  • What elements are found in carbohydrates
    13·1 answer
  • Please please help me <br> !!!!!!!!!
    7·1 answer
  • Explaining hardy Weinberg equilibrium and the eastern squirrel/ how many in the population have the following genotypes
    6·1 answer
  • What is the overall purpose of meiosis?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!