Answer:
b) 6
Explanation:
There are three different alleles (A,B,C) which are responsible for coat coloration but only combination of two can move forward because there are two loci at every homologous pair of chromosomes.
Thus, six combinations can be formed as AA, AB, AC, BB, BC, CC.
RNA molecules attach to codons when the ribosome reaches the start codon.
Explanation:
The start codon initiates translation of the mRNA by the ribosome into a polypeptide. When the ribosome finds the start codon, it attaches to the mRNA and the first amino acid, methionine, is recruited. The ribosome then continues translating the rest of the mRNA until it encounters a stop codon that initiates the ‘knocking off of the ribosome from the mRNA.
Learn More:
For more on translation check out;
brainly.com/question/2273699
brainly.com/question/13572447
#LearnWithBrainly
Answer:
A.) Pollen are well preserved in the sediment layers because they are highly resistant to decay.
B.) Other indicators that can be used to determine past climates are through the analysis of the width of tree rings and the coral reefs formed underwater.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation: