1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natalka [10]
3 years ago
8

Houses have been built around a small retention pond, increasing the fertilizer runoff into the pond. This has led to algal bloo

ms in the pond which periodically reduce the amount of dissolved oxygen available in the water. What will be the most likely long-term effect on the fish population living in the pond if the situation with the fertilizer does not change?
A. The fish population will grow as more offspring are born that can take advantage of the new conditions.

B. The population will be replaced by a different species of fish that consumes algae for food.

C. The fish population will learn to survive with less oxygen and more algae in the water.

D. The population will evolve, leaving only those genetically equipped to deal with low oxygen levels.
Biology
1 answer:
olchik [2.2K]3 years ago
5 0

Answer:

The answer is D. I hope this was helpful!

Explanation:

You might be interested in
Classification of Living Organisms Common Name Bush Anole Crested Penguin Ferret Muskrat Kingdom Animal Animal Animal Animal Phy
jekas [21]

Answer:

c

Explanation:

4 0
3 years ago
What is the difference between hydrophobic and hydrophilic molecules
Jet001 [13]
The hydrophilic molecules are the polar molecules which establishes the hydrogen bonding with the water molecules. Hence the hydrophilic molecules are water loving molecules. The hydrophobic molecules are unable to establish any hydrogen bonding with the water molecules. Hence the hydrophobic molecules are water repellent molecules.
5 0
3 years ago
Which factors affect the environment? How?*​
ludmilkaskok [199]

Answer:

The environment is affected by the biotic and abiotic factors such as temperature, pressure, humidity and organisms like human activity. Some factors that affect environment are the following : a) Greenhouse Effect - Green house gases like C O2, trap the heat from the sun that increase the temperature of the earth.

3 0
2 years ago
The two most important regulatory systems for the maintenance of homeostasis are
LenaWriter [7]
The Nervous System and The Endocrine System.
4 0
3 years ago
Which statement about forces is true? A. Forces are defined by strength but not direction. B. Forces are defined by direction bu
navik [9.2K]

Answer:

C

Explanation:

The direction and strength affect the force

6 0
2 years ago
Read 2 more answers
Other questions:
  • If the entire population of the united states forms a human chain by holding hands, how many times can such a chain be wrapped a
    7·1 answer
  • Which of these is the lowest subgroup<br> A. Kingdom<br> B. Genus<br> C. Species<br> D. Order
    11·2 answers
  • Chemical reactions that release energy?
    12·1 answer
  • True or false: the earths mantle lies directly below the inner core
    5·2 answers
  • Molecular clocks
    7·2 answers
  • A substance with a pH of 6 is called O a base. O neither an acid nor a base. O an acid. O both an acid and a base.
    8·1 answer
  • Explain the mistake you see in image 2
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • (ANSWERED)Suppose you seal a house plant in a transparent glass container. What about the scenario would lead to the plant's dea
    7·2 answers
  • Which cellular process do scorpions most likely go through to
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!