1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vera_Pavlovna [14]
3 years ago
8

When Earth is the closest to the sun,the Northern Hemisphere is in winter. Why is this true?

Geography
1 answer:
Juli2301 [7.4K]3 years ago
8 0

Explanation:

The Earth is closest to the Sun every January, but it is the fact that the north pole of the Earth's axis is tilted away from the Sun at that time of year which causes it to be winter in the northern hemisphere. B. Given the effects of precession, will this still be the case in 13,000 years?

You might be interested in
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What are some actions that you, as an individual, can take to help protect respurces? Write a paragraph discussing at least five
Nastasia [14]

atleast trying to make it renewable as possible, not use it too much, not taking the non renewable one, possibly find a new place that have the enough resource and.. maybe going further into space to use it resource

3 0
3 years ago
REFERATE- un referat :<br> Calatoriile lui Marco Polo
NARA [144]

Answer:

i can't answer it

Explanation:

cause i didn't understand your question

5 0
3 years ago
Which best describes how sediment forms? A. Loose material is compacted by pressure. B. Chemical changes cause sediment to cemen
Alecsey [184]

Sediments are defined as solid fragments of inorganic or organic material. The bulk of sediment is formed from the weathering of rock, wherein the rock is broken into smaller and smaller pieces by a variety of chemical and mechanical processes, including acidic rainfall, freeze/thaw cycles, and the actions of organisms.

So I believe the answer is right let me know

3 0
3 years ago
Tanisha says that the moon looks dark from earth when the moon is in 2 different places
sattari [20]

Answer:

true

Explanation:

3 0
3 years ago
Other questions:
  • The land separating adjoining valleys is known as a(n ________.
    9·1 answer
  • The capital of U.A.E?
    5·2 answers
  • Transplanting tomatoes from pots to aquaponics system. 
    11·1 answer
  • Who were the British allies with and how did they help then to win so many battles?
    13·1 answer
  • (04.02 MC) EXPLAIN!!!!!!!!!!
    5·2 answers
  • During most of the year, the air over Daytona Beach contains a great amount of moisture.
    6·1 answer
  • Why does India have a monsoon type of climate..? ​
    10·1 answer
  • Answer, and u get 2 questions answered or a brain if ur lucky
    13·2 answers
  • Job specialization encouraged __________ in early city cultures. A. leisure time B. war and crime C. religious persecution D. ec
    6·2 answers
  • Jt90916 is bad. satyam is good
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!