1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
emmasim [6.3K]
3 years ago
13

What is the domain of the function in this table?

Mathematics
1 answer:
prisoha [69]3 years ago
5 0

Answer:A

Step-by-step explanation:

f=(x)

You might be interested in
What percent of 80 is 3.2
abruzzese [7]
Its 4% do i get brainiest???

5 0
3 years ago
Read 2 more answers
A game and a controller are on sale for 45% off. The regular price of the game is $80. The regular price of the controller is $1
erma4kov [3.2K]
It is 36

Explanation:
80/100 = 0.8
0.8*45 = 36
3 0
3 years ago
Suppose A and B are independent events if P(A) = 0.4 And P(B) = 0.1, what is P(A'uB)? APEX
Aloiza [94]
For Independent Events, P(A) × P(B) = P(A∩B)

so we have, P(A∩B) = 0.4×0.1 = 0.04

P(A') = 1 - 0.4 = 0.6

This information can be represented on a Venn diagram as shown below

P(A'∪B) means the union of everything that is not A with everything that is B

P(A'∪B) = 0.06 + 0.54 + 0.04 = 0.64


5 0
3 years ago
Help please little I try my best
Marat540 [252]
The answer is (3,0). Hope this helps!(:
6 0
3 years ago
Evaluate 1/2m - 2/3n when m = 3 and n = 8.
Anika [276]

Answer:

1/2(3)-2/3(8)

3/2-9/3

<u>3</u>-<u>9</u>

2.3

<u>9</u><u>-</u><u>3</u><u>2</u>

6

<u>-23</u>

6

7 0
4 years ago
Other questions:
  • Amy thinks that 5 to the power of 3 is 3x 3 x 3, or 27. Explain what Amy is doing wrong.
    8·1 answer
  • With the 20% off coupon, Alexis received a discount of $15 on her shoes. What was the regular price of her shoes before the 20%
    14·2 answers
  • The beginning inventory at cost is $80,000.00 and at retail is $100,000.00. Purchases at cost are $160,000.00 and the retail val
    13·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • PLEASE HELP URGENT PLEASE HELP apply the definition of subtraction and properties of operations to find the result. 1/8 - 3/7 -
    10·1 answer
  • Tryna figure this out
    11·1 answer
  • The Questions above.
    8·1 answer
  • 2) You had $20 to spend on seven avocados. After buying them you had $6. How much did cach avocado cost? Answer​
    11·1 answer
  • Which number is irrational
    13·1 answer
  • Evaluate: 7.921 x 104.<br> 79,210,000<br> 7,921<br> 792.1<br> 79,210
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!