1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Arada [10]
3 years ago
7

Needed ASAP The point where the lever rocks back and forth is called _______ or ________

Biology
1 answer:
Orlov [11]3 years ago
6 0

Answer: the fulcrum

i don't know the other one

You might be interested in
Somebody help me please
goldenfox [79]

Answer: B

Explanation:

I think it is either A, B. I think it is B because Butter is a saturated fat and is saturated with hydrogens. This makes it solid. They are made from animal fats that contain saturated fatty acids that are solid at room temperature. Soft margarine is made of plant fats which remain liquid at room temperatures like the corn oil. -I searched this up UnU Hope this helps.

4 0
3 years ago
What career opportunities are there is the field of
labwork [276]

Explanation:

biotech. engineering, there are a lot of biotech engineers, bcause they no how to cross breed corn, beans, wheat, etc....2 make plants 2 resist drought, stronger against pests, etc....

5 0
3 years ago
What group are mammals from ?
raketka [301]

These three groups are monotremes, marsupials, and the largest group, placental mammals.

6 0
4 years ago
Read 2 more answers
The volcanic landform that is formed when the more resistant volcanic pipe remains after most of the cone has been eroded is cal
Free_Kalibri [48]
It is called a volcanic neck
5 0
3 years ago
Read 2 more answers
Myocardial cells have long refractory periods in order to ensure each contraction is____. This is
koban [17]

Answer:These contractile elements are virtually identical to skeletal muscle. ... (a) Cardiac muscle cells have myofibrils composed of myofilaments arranged in sarcomeres, ... The refractory period is very long to prevent the possibility of tetany, a ... At this point, the calcium ion channels close and K+ channels open, allowing outflux ..

Explanation:

7 0
3 years ago
Other questions:
  • In addition to phospholipids, which of the following organic molecules are also a part of cellular membranes?
    7·1 answer
  • The rectal route is preferred over the oral route for certain emergency medications because:
    14·1 answer
  • White tip reef sharks spend most of the day lying on the ocean floor. While remaining still, these sharks pump water across thei
    10·2 answers
  • Which of the following best defines a gene pool
    12·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • The two main types of plants are _____. mesophytes and xerophytes vascular and nonvascular angiosperms and gymnosperms
    10·2 answers
  • In which type of environment are plants most likely to use a C4 pathway of carbon fixation? cold and wet cold and dry hot and we
    12·2 answers
  • Help!!! 50 Points!!!
    8·2 answers
  • The large population of microbes that contribute to the gut microbiota and have an important role in food processing are called:
    10·1 answer
  • True or false? to perform abg punctures, a phlebotomist must undergo extensive training.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!