1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
2 years ago
5

Which organelle produces the cells energy

Biology
2 answers:
Zinaida [17]2 years ago
6 0

Here is a Answer to your question:

Mitochondria

Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).

I am sorry if this was not helpful

Hope this was helpful

netineya [11]2 years ago
4 0

Answer:

Mitochondria

Explanation:

You might be interested in
Why might genetically identical twins have different phenotypes?
jeka94
They may have different phenotypes because of differences in their environments, such as nutrition and healthcare.
4 0
3 years ago
What do scientists typically do before formulating a testable hypothesis?
Leokris [45]
they conduct a literature review before formulating any hypothesis. carrying out a literature review involves utilizing research databases to look for research materials that cover or are related to a certain topic of interest. the scope of the study and subject matter will influence the selection of research materials. information in these material play a crucial role when scientist are formulating hypothesis. 
3 0
3 years ago
Read 2 more answers
A marine biologist explains that salmon show overproduction, which allows natural section to work. What is "overproduction"?
Stella [2.4K]
<span>The birth of more offspring than can survive.</span>
6 0
3 years ago
Read 2 more answers
Function of a<br> tight Junction in animal cell
KonstantinChe [14]

Answer:

A tight junction is a watertight seal between two adjacent animal cells, which prevents materials from leaking out of cells.

Explanation:

7 0
2 years ago
Which of the following statement(s) is/are true regarding the adrenal glands' relationship with the autonomic nervous system?
Studentka2010 [4]

Answer:

The true statements regarding the adrenal glands' relationship with the autonomic nervous system are:

a. The adrenal cortex is an extension of the parasympathetic nervous system.

c. The adrenal glands are strictly nerve tissue.

d. The parasympathetic division stimulates the adrenal cortex to secrete glucocorticoids.

e. The adrenal medulla is penetrated by the fibers of the sympathetic nervous system.

Explanation:

The  levels of the central nervous system which play important roles in influencing the autonomic nervous system include cerebral cortex, hypothalamus, brain stem, and spinal cord.  Usually, epinephrine (adrenaline) and norepinephrine are released into the blood stem when stress or a threat occurs.  This alert serves as a warning signal and defense system.  The purpose is to maintain homeostasis.

4 0
3 years ago
Other questions:
  • Ocean acidification is the result of cars releasing _______.
    14·1 answer
  • When a molecule of double-stranded DNA undergoes replication, it results in
    14·1 answer
  • Which of the following are NOT molecules that can move through the cell
    13·1 answer
  • The mother of a 16-year-old girl calls the emergency department, suspecting her daughter's abdominal pain may be appendicitis. i
    14·1 answer
  • How does the size of the olfactory bulb in sheep compare to the size in humans? What might this tell you about the sense of smel
    13·1 answer
  • Millions of years ago, a small population of birds lived on the Hawaiian Islands. Over time, this population evolved into more t
    12·2 answers
  • Oxygen Consumption can be used as a measure of metabolic rate because oxygen-
    5·1 answer
  • If an astronaut had a mass of 30 kg on the moon, what would his mass be on Earth?
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • SKI
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!