1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrey2020 [161]
3 years ago
11

I need to know the bonds of that molecule.

Biology
1 answer:
posledela3 years ago
4 0

Answer:

I would need more info

Explanation:

You might be interested in
When two species interact in a way that is beneficial to both species this is what kind of relationship?
Step2247 [10]

Answer:

B

Explanation:

Mutualism is a relationship between two species in which both species benefit. Certain species of bacteria in your intestines form a mutualistic relationship with you.

3 0
3 years ago
Read 2 more answers
What is the process (scientific equation)of respiration?
Varvara68 [4.7K]

Answer:

C6H12O6 + 6O2 -> 6H2O + 6CO2 + Energy

**Glucose + 6 Oxygen -> 6 Water + 6 Carbon Dioxide + Energy**

3 0
3 years ago
Suppose that an arginine residue in the active site of an enzyme was mutated to alanine. As expected, the alanine mutant was ina
kolbaska11 [484]

Answer:

c. A to K

Explanation:

If the alanine mutation is restored to K or lysine residue, most likely the wild type level of activity can be restored. This is because, arginine and lysine have -NH2 as the functional group. So, functional similarity of arginine can be expected from lysine as well.

Hence the correct option is c that is A to K.

7 0
3 years ago
WHAT IS PHOTOSYNTHESIS ??​
kykrilka [37]

Explanation:

Photosynthesis is the process by which plants use sunlight, water, and carbon dioxide to create oxygen and energy in the form of sugar

4 0
3 years ago
Read 2 more answers
What is the correct sequence of events in transcription and translation?
egoroff_w [7]
The answer is B, DNA to RNA to protein
8 0
3 years ago
Other questions:
  • In a gene cloning experiment, why are white colonies desirable (rather than blue colonies)?
    11·1 answer
  • Many cultures and religions have customs which deal with the way they use the land. For example, in Judaism, it is required that
    12·2 answers
  • This is a DNA fingerprint exhibiting samples from a victim, two suspects, and the crime scene. Which of these DNA fragments is c
    10·1 answer
  • Semen is a combination of A) fluid from the seminal glands and bulbo-urethral glands B) fluid from the prostate and sperm C) sem
    10·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which action is most likely to stop succession and make an ecosystem less
    8·2 answers
  • What tool is more precise to measure the volume of water and why?
    13·1 answer
  • When a population is split into smaller groups, why do these groups develop different traits?
    6·2 answers
  • Explain one way that carbon gets back into the atmosphere?
    6·1 answer
  • __________ disease is associated with the bilateral calcification of the amygdalas and surrounding areas of the anterior medial
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!