1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ad libitum [116K]
2 years ago
9

Explain how surface water is able to form on permafrosts able to form on permafrost

Biology
2 answers:
Ganezh [65]2 years ago
5 0
Just as a puddle of water freezes on a frigid winter night, water that is trapped in sediment, soil, and the cracks, crevices, and pores of rocks turns to ice when ground temperatures drop below 32°F (0°C). Permafrost is any ground that remains completely frozen—32°F (0°C) or colder
Lina20 [59]2 years ago
3 0
<h2><em>explain how surface water is able to form on permafrosts able to form on permafrost</em></h2>

  • <em>Just as a puddle of water freezes on a frigid winter night, <u>water that is trapped in sediment, soil, and the cracks, crevices, and pores of rocks turns to ice when ground temperatures drop below 32°F (0°C).</u></em>

<em><u>hope </u></em><em><u>it</u></em><em><u> helps</u></em>

<em><u>#</u></em><em><u>c</u></em><em><u>a</u></em><em><u>r</u></em><em><u>r</u></em><em><u>y</u></em><em><u> </u></em><em><u>on</u></em><em><u> learning</u></em>

You might be interested in
Changes that living things undergo as they grow
artcher [175]
<span>Like any other change, when an organism undergoes growth over time it is referred to as development -a life process.

</span><span>1. Uses the light of the sun to create food and be distributed and passed to other organisms thru the food chain: Photosynthesis
2. The ability of an organism's physiology to maintain internal environment regardless of the external environment: Homeostasis
3.  <span>A process that helps in chemical transformations within the cells of all living organisms: Metabolism
4. is the ability of an organism to exchange gases vital to organismic growth and survival: Respiration
5. The ability of an organism to produe offsprings: Reproduction</span></span>

8 0
3 years ago
Which organisms can conduct photosynthesis?
bezimeni [28]
The answer is a. Plants, algae, and certain Protista
3 0
3 years ago
Read 2 more answers
Which molecule is most commonly found covalently linked together to form in polymers of carbohydrates?.
katrin2010 [14]
Glucose monomers are found
5 0
2 years ago
Why is it so important to keep a microscope covered when not using it?
valkas [14]

Because the rays of the light might reflect and crack the lens

3 0
3 years ago
Read 2 more answers
What happened to the deer population when the number of wolves was low?
hammer [34]
I think the population of deer will increase
3 0
3 years ago
Other questions:
  • When a child is born with trisomy, when did the mutation occur?
    15·2 answers
  • Your eye color, gender, and hair color are all determined by the DNA in your genes. Where are these genes located?
    11·1 answer
  • How did Ichthyosaurus survive? Be specific.
    10·1 answer
  • Explain what occurs in cell differentiation and morphogenesis
    14·1 answer
  • The structure identified in the image above is called the ​
    14·2 answers
  • Which of the following describes the nervous system integrative function?
    15·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • DNA is like a 1) _________________ much as the specific sequence of letters on base pairs are like 2) _____________ and 3) _____
    10·1 answer
  • The bacteria species known as Escherichia coli is capable of using oxygen to produce energy in a process known as respiration. I
    6·2 answers
  • Conduction is the transfer of heat through
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!