1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ioda
3 years ago
11

A dog walks 15 meters at a speed of 2 meters every second. How long did it take?

Biology
2 answers:
Mademuasel [1]3 years ago
4 0

Answer:

7.5 seconds

Explanation:

scZoUnD [109]3 years ago
3 0

Answer:

30

Explanation:

You might be interested in
Should guys with moobs wear bras in public?
krek1111 [17]
I think it’s up to them. But personally I don’t think it matters and I wouldn’t even be paying attention to that sorta thing.
7 0
3 years ago
Read 2 more answers
( I really need help on this)A compound microscope uses
antiseptic1488 [7]

the third potion listed is the correct answer. because in its name it implies that there is more than one lens

3 0
3 years ago
The introduction of livestock to an area leads to over-grazing that removes native grasse
grin007 [14]

Invasive species. Native grasses have evolved with the normally-occurring grazing organisms to achieve a level of reproduction which sustains the grasses despite the grazing. An invasive species disrupts this ecological balance that took millions of years to develop by eating the grass at a rate that exceeds the rate for the grass to re-seed itself and maintain its own population. The invasive species easily decimates the grass population.

6 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Which characteristics do all bacteria and archaea have in common?
Alex Ar [27]

Answer:

c

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • The picture shows an experimental set up for the process of osmosis. The potato has a cavity on top, as shown in the picture. So
    15·2 answers
  • What are non examples of biome?
    12·2 answers
  • A student reported that a limp stalk of celery became crisp when placed in ice water
    6·2 answers
  • Please helpp
    8·1 answer
  • What is Thalassemia???​
    12·2 answers
  • What would happen if Glucoses could not happen in a cell
    9·1 answer
  • What is a bottle terrarium ??<br><br>Help;). <br><br><br>Give 4 to 5 sentence ​
    13·1 answer
  • A component of the wet slurry produced by the scrubbing process is ?
    10·1 answer
  • What is pollution?????​
    15·2 answers
  • True or false: the tubuloglomerular feedback mechanism acts as a 'backup' mechanism to the myogenic mechanism in response to inc
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!