Nutritional value facts are usually at the side of the container which you bought, they give you the trans fat, calories, serving size, sodium, sugar, cholesterol, carbohydrates (carbs), protein, and the type of vitamins found.
--hope this helps :)--
Answer:
There are many reasons why manned space probes to Saturn are simply unachievable. Getting to space is incredibly hard. The force of gravity is very hard to escape. If you wanted to, you would have to invest trillions upon trillions of dollars to create a space shuttle that may or may not explode. Second, we simply don’t have the technology to make it that far with a manned probe. Saturn is more than a billion miles away. It would take more than several years to go that far. To keep astronauts alive, entertained, and sustained is also a big challenge. In conclusion these are some reasons why a manned space probe to Saturn is unachieveable.
Explanation:
U’d better give me that brainly.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Large polymers are created during dehydration synthesis, which are typically referred to as biological macromolecules. These compounds include proteins, lipids, carbohydrates, and nucleic acids.
As a result, the dehydration reaction is responsible for the formation of protein, lipid, and nucleic acids.
1. Protein structure
- Amino acid polymers form proteins. There are four different types of proteins, based on structure.
- The amino acid sequence of a protein is represented by its primary structure, which is a linear chain.
- The backbone (main chain) atoms of a polypeptide are arranged locally in space to form the protein's secondary structure.
- A polypeptide chain's whole three-dimensional structure is referred to as a protein's tertiary structure.
- The protein's quaternary structure, which is a three-dimensional arrangement of the subunits of a multi-subunit protein.
2. Lipid structure is a crucial element of the cell membrane. The structure is mostly composed of a glycerol backbone, two hydrophobic fatty acid tails, and a hydrophilic phosphate group.
3. Nucleic acids' structure: Nucleotide polymers make up nucleic acids. Each nucleotide is made up of an aromatic base with a N-atom connected to a pentose sugar with five carbons, which is then joined to a phosphate group.
To know more about biological macromolecules visit:
brainly.com/question/2141678
#SPJ4
Answer: experiments
Explanation: ap ex certified
