1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anton [14]
3 years ago
12

What do you mean by ligulate?​

Biology
1 answer:
tatuchka [14]3 years ago
7 0

Answer:

Ligulate definition is - furnished with ligules, ligulae, or ligulate corollas. How to use ligulate in a sentence.

You might be interested in
How was the present day theory of evolution developed?
NeTakaya

I believe that present day was a theory that became a evolution developed because it was a historical event involved

7 0
3 years ago
1. What is the limiting factor for most animal life in the open ocean?
Minchanka [31]

Answer:

Biotic: <em>Food availability</em>

Abiotic: <em>Temperature</em>

Explanation:

There are two types of limiting factors for biodiversity: biotic and abiotic. Biotic refers to living things, for example, organisms that are an important food source. <u>Most animal life forms in the ocean highly depend on the availability of a food source</u>. If food is limited or scarce, the populations of a given species could face significant declines.

On the other hand, there are abiotic factors, which refer to factors that are not alive, such as physical factors. For instance, temperature and light. <u>For marine organisms, temperature is a critical factor.</u> Even an increase of 'only' 1 ºC could make a huge difference in the survival of a species as it could disrupt their ability to forage, hunt, or perform physiological processes, <em>e.g.</em> metabolism.

Therefore, <u>if we refer to a biotic factor, food availability is a limiting factor for most animal life in the open ocean, whereas, if the refer to an abiotic factor, temperature (and light) are limiting factors for pelagic life.</u>

4 0
3 years ago
Robert is a 15-year-old boy. His recommended dietary intake for vitamin B12, C, and E is 2.4 µg/day, 75 mg/day, and 15 mg/day, r
ANTONII [103]
B. Vitamin B12 and C only. If you just add them up through each column and compare what he is supposed to have to what he gets in the meal then you will see he only meets his recommend B12 for the day and at least 75% of Vitamin C. 
5 0
3 years ago
Read 2 more answers
What part of a nucleic acid allows it to be used to form a code
Feliz [49]
Did you try the fact that the DNA sequences are copied
7 0
3 years ago
Read 2 more answers
Which option denotes the professional that most likely will be called in to help in the following scenario?
rjkz [21]

The professional that most likely will be called in to help seismologist.

<h3><u>Explanation:</u></h3>

When an underwater earthquake has just been recorded in the middle of the Pacific Ocean, the seismologists will be called to determine if the effects of this earthquake and whether or not it will cause tsunamis off the coast of Hawaii.

Seismology is the study of earthquakes, the escalation of waves and the effects they might have. A seismologist is a scientist who is concerned with these studies. They make use of seismographs and other relevant tools to gather essential data which helps in reading the planetary movements and understanding them better. The study does not always predict an earthquake but it helps in predicting the possibility of tsunamis. Seismology enabled the development of tsunami warning systems.

5 0
3 years ago
Other questions:
  • A nursing student has been assigned to care for a client with digeorge syndrome. the student has reviewed the clinical manifesta
    9·1 answer
  • What is a characteristic that is not present in all living things?
    5·1 answer
  • Is the only metal that is not solid at room temperature.
    8·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Why are globular proteins important? What are their primary functions and what are they made of?
    6·2 answers
  • Rigor mortis that occurs in skeletal muscles a few hours after death is due to
    12·1 answer
  • Question 4 (1 point)
    5·1 answer
  • Draw the Punnett squares and write out the phenotypes pls ??☺​
    12·1 answer
  • How is hyaline cartilage different from elastic or fibrocartilage?
    7·1 answer
  • I am thinking of an animal that kind of looks like a raccoon, and starts with an A. With just that information: what is the comm
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!