1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fomenos
3 years ago
15

Can someone please help?? Most of the eastern United States is a _____ biome.

Biology
2 answers:
vekshin13 years ago
6 0

Answer:

eco biome

Explanation:

enyata [817]3 years ago
3 0

Answer:

Most of the eastern United States is a TROPICAL RAINFOREST bione

Explanation:

You might be interested in
#1 Why would one species of macroinvertebrate be more sensitive to pollution
klemol [59]

Answer: predator species would be more sensitive by accumulating toxic material already accumulated in individual prey. It would also depend on different levels of pollution in different niches, so that one species would be more exposed.

Explanation:

Self explanatory

5 0
3 years ago
Pictured below is the inducible soap operon of the pseudomonas species growing in the oncology ward. imagine the operator has be
pav-90 [236]
The growth on soap would not change that much, it will just change a little or just a bit of its part, but the damage would decrease the species growth elsewhere. Growth on soap will not change, but the damage had the chance to decrease the species growth elsewhere.
3 0
3 years ago
When using a light microscope, focus the specimen with the scanning objective lens first.
nasty-shy [4]

Answer :

goggle has the answer i got the same question as u

Explanation:

8 0
2 years ago
Read 2 more answers
The smell from a pot of stew wafts through the house because
melisa1 [442]

Answer:

The liquid vaporizes and the resulting gas molecules wander about the room.

Explanation:

I just took the quiz on APEX.

7 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Other questions:
  • Plz need help ASAP!!!!! (20 pts) Will give brainliest!!!
    7·1 answer
  • White meat contains (less/more) myoglobin than red meat, Red meat contains more (slow/twitch) muscles than white meat does.
    15·1 answer
  • What are. Some of nicolaus copernicuses achievments
    14·1 answer
  • The motion of two or more waves passing through the same medium at the same time is called?
    10·1 answer
  • A scientist finds an organism that cannot move. It has many cells, procedures spores, and gets food from its environment. In whi
    5·2 answers
  • Would a desalination plant be beneficial to your local area? Explain why or why not.
    15·1 answer
  • How did the black codes make African Americans' lives similar to that before the Civil War?
    9·2 answers
  • Ronmental Science
    13·1 answer
  • What do the following results from the TEST FOR LIFE tab indicate about the sample?
    7·1 answer
  • Type the correct answer in the box. Spell all words correctly.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!