1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
expeople1 [14]
3 years ago
8

Water moves via osmosis _________. a) from an area with a low concentration of water to one of higher concentration b) from an a

rea with a high concentration of other solutes to a lower one water does not move throughout the cytoplasm c) from an area with a high concentration of water to one of lower concentration
Biology
2 answers:
sp2606 [1]3 years ago
8 0

Answer: c) from an area with a high concentration of water to one of lower concentration

Explanation:

Microscopically, we can interpret osmosis as the passage of water through holes in the membrane. These holes are small enough to allow water to pass through, but not to the ions that carry a layer of hydration, that is, a layer of water molecules around them. Water flows through the membrane in both directions. However, the occurrence of osmosis indicates that the flow is more intense in the direction of the less concentrated medium to the more concentrated. Thus, there is an effective flow of water in one of the senses, called osmosis, from an area with a high concentration of water to one of lower concentration.

Ksivusya [100]3 years ago
5 0

Answer: The answer is C.

Explanation:

You might be interested in
Plz help me with this.....
NARA [144]

Answer:

It is because of Evaporation. The wind evaporates the water on your skin which in turn absorbs the heat from your skin. Wind and heat both help to evaporate that water and hence you feel cold. Water evaporates from your skin using up your body heat.

Explanation:

I hope this helps!

6 0
2 years ago
if a cell was a sugar factory, suggest an organelle or organelles whose function would be analogous to the following; 1. head of
faltersainse [42]

Answer:

Head Office = Nucleus

Explanation:

The nucleus is the most important job/part of a cell. It controls everything.

8 0
2 years ago
Read 2 more answers
How does adaptation affect the diversity of an ecosystem
dolphi86 [110]

Answer:

Adaptation affects the diversity of an ecosystem by helping organisms survive different harsh conditions as well as survive their environment.

Explanation:

4 0
3 years ago
What is the process of cell division in prokaryotes?
Nina [5.8K]
Cell division<span> is part of the life cycle of virtually all</span>cells<span>. </span>Cell division<span> is the </span>process<span> in which one </span>cell<span>divides to form two new </span>cells<span>. Most </span>prokaryotic cells<span>divide by the </span>process<span> of binary fission. In eukaryotes,</span>cell division<span> occurs in two major steps: mitosis and cytokinesis.</span>
3 0
3 years ago
Please help<br> Explain how independent and dependent variables apply to life
Crazy boy [7]

Answer:

If one wants to estimate the cost of living of an individual, then the factors such as salary, age, marital status, etc. are independent variables, while the cost of living of a person is highly dependent on such factors. Therefore, they are designated as the dependent variable.

4 0
2 years ago
Other questions:
  • Why is active transport necessary for the sodium-potassium pump to work?
    5·2 answers
  • Which organism can reproduce using the process of fragmentation
    8·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Dopamine is a neurotransmitter involved in the reward pathways in the brain, and its decreased activity has been associated with
    6·2 answers
  • Give a scenario where a cell may need to perform a form of endocytosis
    6·1 answer
  • 40 POINTS
    6·2 answers
  • How would signaling be affected if a mutation caused a g protein to replace gdp with gtp on its own without needing to be activa
    15·1 answer
  • What are the materials use for the nucleus and cytoplasm when making a 3D animal cell model?
    13·1 answer
  • Are atoms completely lost or gain in a chemical re
    8·1 answer
  • What does heterozygous mean?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!