The answer i think it changes
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
<h2>
Answer:</h2>
The Mesozoic era is featured by the arousal of <u>b. birds</u>.
<h2>
Explanation:</h2>
The Mesozoic Time is the age of the dinosaurs and kept going nearly 180 million a long time from around 250 to 65 million a long time back. It includes periods called the Triassic, Cretaceous, and Jurassic periods. A mass-extinction stamped the starting and conclusion of the Mesozoic Period. The occasion that caused the move from the Paleozoic time to the Mesozoic period was the most prominent termination this soil has seen.
There's noteworthy prove that birds developed inside theropod dinosaurs, particularly, that winged creatures are individuals of Maniraptora, a category which belongs to dinosaurs period.
A community which is a ecosystem
