1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
4 years ago
6

PLEASE HELP ME!!!!!!!!!!!!!!!!!!!!!

Biology
1 answer:
Nutka1998 [239]4 years ago
7 0

Answer:

I think it's D. Runoff

You might be interested in
Evolution is the process by which populations of organisms change over time. How could natural selection lead to evolution?
cupoosta [38]

Answer:

happy Teddy day I love Teddy

4 0
3 years ago
HELP ASAP PLS IM GETTING TIMED
Finger [1]
The answer i think it changes
4 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Which of the following organisms arose during the Mesozoic Era? a. mammals c. insects b. birds d. salamanders
Harlamova29_29 [7]
<h2>Answer:</h2>

The Mesozoic era is featured by the arousal of <u>b. birds</u>.

<h2>Explanation:</h2>

The Mesozoic Time is the age of the dinosaurs and kept going nearly 180 million a long time from around 250 to 65 million a long time back. It includes periods called the Triassic, Cretaceous, and Jurassic periods. A mass-extinction stamped the starting and conclusion of the Mesozoic Period. The occasion that caused the move from the Paleozoic time to the Mesozoic period was the most prominent termination this soil has seen.  

There's noteworthy prove that birds developed inside theropod dinosaurs, particularly, that winged creatures are individuals of Maniraptora, a category which belongs to dinosaurs period.

8 0
3 years ago
Organisms interact with each other and with the nonliving environment them in a/an ____
LUCKY_DIMON [66]
A community which is a ecosystem
5 0
3 years ago
Other questions:
  • Is a type of specialized cell whose main function is to communicate between neurons?
    7·1 answer
  • Induced pluripotent stem cells are ?
    11·2 answers
  • Why do people say that the sun set when it doesn’t
    13·2 answers
  • Which statement would best explain why the carbon cycle is often referred to as the carbon oxygen cycle
    7·1 answer
  • In cows, fur color is codominant. Cross a spotted cow with a black bull. What percent will be spotted?
    11·1 answer
  • Consider the case of in vitro evolution used to generate RNA molecules with ligase activity. If the researchers repeated the inv
    14·1 answer
  • Which organisms are best suited to tolerate the conditions of their environment
    9·1 answer
  • If one lesions the primary auditory cortex of a cat, the generalization gradient:
    15·1 answer
  • Which of the following is not a major conclusion of the US Army Corps of Engineers' report on Hurricane Katrina?
    7·2 answers
  • A human blood cell is placed in fresh water. As a result, water moves _____ the cell
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!