1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
aleksandrvk [35]
3 years ago
12

What phenotype is grey

Biology
1 answer:
kipiarov [429]3 years ago
5 0

Answer:

For example, the typical body colour phenotype is grey. One mutant produces an ebony (shiny black) body colour. Because this allele is recessive, it is symbolized by a lower-case letter, e.

Explanation:

You might be interested in
Which of the following does NOT affect the flow of groundwater through an aquifer ? a. porosity C. gradient b . chemical weather
creativ13 [48]

Answer:

b . chemical weathering

Explanation:

Chemical weathering is not affected the flow of groundwater through an aquifer but affect by the porosity and permeability. The rate of groundwater flow is controlled by two properties of the rock which are porosity and permeability. Porosity is the percentage of void space in a rock while on the other hand, Permeability is the quality of being permeable means able to be penetrated or passed through by a liquid or gas.

4 0
3 years ago
Why patients with moscular dystrophy suffer from breathing and heart malfunction!?
tamaranim1 [39]
Muscular dystrophy is a muscle disease that causes a loss in muscle mass and weakness. Patients with muscular dsytrophy may experience a weakening in their cardiac muscles, causings heart malfunction. Muscular dystrophy can also deteriorate the diaphragm, a muscle that solely aids in respiration, causing a breathing malfunction.
4 0
4 years ago
The process of converting outside stimuli into neural activity is called __________.
Zigmanuir [339]
The process is called Transduction
6 0
3 years ago
What are the reactants in cellular respiration? what are the products?
Gwar [14]
Cellular respiration is the process of releasing energy from the food that one had taken. The reactants of the cellular respiration were both oxygen and glucose. The main product of this process would be ATP (adenosine phosphate) but could also be H2O and CO2. 
3 0
4 years ago
Read 2 more answers
Please help :). Will give brainiest!! I only need the first part don’t answer #2 or #3
marysya [2.9K]
It should be
AGATACCATGGTTACCCGGTTCCA
6 0
3 years ago
Other questions:
  • Explain how minerals form in diagram c
    9·1 answer
  • What do starch and cellulose have in common?
    15·1 answer
  • Do you like cats or dogs better<br> Explain why?
    8·2 answers
  • 3. Sarah, who has a mass of 55 kg, is riding in a car at 20 m/s. She sees a cat crossing the street and slams on the brakes! Her
    11·2 answers
  • Select the statement that correctly describes multiple sclerosis.
    15·1 answer
  • ______ions are necessary to activate the binding sites on the actin filaments. The molecule ____ is required each time the myosi
    11·1 answer
  • Bats hunt using echolocation, in which they send and receive high frequency sounds to locate prey. When bats hear the sounds of
    12·2 answers
  • HELP PLS FOR A REAL ONE
    13·1 answer
  • I need help pls someone
    10·2 answers
  • Platelets release __________, a chemical vasoconstrictor that contributes to the vascular spasm.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!