1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
WINSTONCH [101]
3 years ago
10

Number 2 is the one that needs to be answered

Biology
1 answer:
velikii [3]3 years ago
5 0

Answer:

2. The US uses far less renewable energy than most other countries.

Explanation:

US uses very less renewable entgy in comparison to other countries because of several reasons such as:

  • overall cost of renewable energy is very high.
  • limitations to geography.
  • can cause pollution, such as biomass.
  • fossil fuels are more reliable as do not depend on other environemntal fluctuations such as solar light.

Hence, the correct option is 2.

You might be interested in
1)Chloroplast and chlorophyll are one and same thing T or F ?
Svetradugi [14.3K]
1) False.
2)False.
3)True.
6 0
3 years ago
Read 2 more answers
Which of the following is NOT one of the four main groups of macromolecules of living things?
spayn [35]

Answer:

D

Explanation:

polysaccharides is NOT one of the four main groups of macromolecules of living things

4 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Questions about ecosystems
Hitman42 [59]

Answer: In which of the following options can competition occur? ...

Which of the following do plants usually compete for? ...

In which of the following options does interspecific competition occur? ...

What is biodiversity? ...

What is an ecosystem? ...

What are all organisms living in a particular area known as?

HOPE THIS HELPS

5 0
3 years ago
What did the yellowing of the phenol red indicate about the antacid (Rolaids)?
Alla [95]
Yellow-indicates acid production from fermentation of the carbohydrate lower the pH below the neutral range
3 0
3 years ago
Other questions:
  • Which of the following is true about biochemistry?
    5·2 answers
  • All connective tissue is formed from which embryonic germ layer?
    9·1 answer
  • 1. How does inflammation help the immune system to fight<br> pathogens?<br> II
    8·1 answer
  • What type of protein does a pump require?
    7·1 answer
  • What therapy cures genetic disorders by inserting normal genes into sales with mutant genes?
    12·1 answer
  • Blank ?, amount of sugar, and amount of water are some conditions that need to be right in the
    13·2 answers
  • Describe the role of a decomposer in a food web.
    12·1 answer
  • What is true of both DNA and RNA?
    10·1 answer
  • Which species is most closely related to the red panda? provide evidence below(optional)
    9·1 answer
  • What are gametes? When they go through meiosis are the daughter cells exactly the same or different?
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!