1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
daser333 [38]
3 years ago
15

How is fresh water collected in the rain forest?

Biology
2 answers:
Ymorist [56]3 years ago
7 0
Answer:



Fresh water is collect by vines, roots, palm trees and condensation. You can also follow the animals to find the water!

I hope this helps you!!!!
uranmaximum [27]3 years ago
4 0

Answer:

if you mean how you can gain water in the rainforest?

Kindly, look at below ^_^

Explanation:

The role of rainforests in the water cycle is to add water to the atmosphere through the process of transpiration (in which plants release water from their leaves during photosynthesis). This moisture contributes to the formation of rain clouds, which release the water back onto the rainforest.

Water Basics

 

The first thing you should do if you're stranded in the wild is find a source of drinkable water. The most obvious sources are streams, rivers and lakes. Animals always know where the water is, so be on the lookout for wildlife or animal tracks. Lush green vegetation is also a sign that water is nearby. Swarming insects may be a hassle, but they also signal that a water source isn't far away. Bird flight paths in the morning or evening can point you in the right direction. Stay on the move until you find a water source. When you pause to rest, use your ears -- rivers can be heard in the quiet woods from great distances. Remember that water always flows downhill, so low-lying areas and valleys are a good bet.

If you find a muddy area, there may be groundwater available. Dig a hole about a foot deep and one foot in diameter and wait. You may be surprised to find that the hole is soon filled with water. This groundwater will be muddy, but straining it through some cloth will clean it up, and it will get you by in the short term. It's crucial to remember that any time you drink found water without purifying it, you're taking a risk.

HOPE THAT ASSESS YOU ...

You might be interested in
Please help me fast and show all your work please thx ​
jenyasd209 [6]

Answer:

1.) A word used to describe the amount of water vapor that is in the air.

2.) The humidity's number percentage.

3.) A meteorologist studies atmosphere...Their primary focus is on the atmosphere's humidity.

8 0
3 years ago
Read 2 more answers
An experiment measures the breaking point of identical strips of Woodgate from different trees. The procedure must contain which
aleksandrvk [35]
Hdhdhdhdhbsbzbzhzbsnhx

6 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
Select the plant phyla.
Triss [41]
Brachiopoda hope this helps :)
6 0
3 years ago
Polaris is called the North Star because
kirza4 [7]
A is the correct answer to the question
3 0
3 years ago
Other questions:
  • Why must matter be recycled on earth
    9·1 answer
  • What is the name of the enzyme required in the 8th step of the citric acid cycle?
    6·1 answer
  • What is the answer plz ?
    8·1 answer
  • What is the bonds between nitrogen bases?
    10·1 answer
  • On Earth, old matter is recycled into new matter.<br><br><br> True <br> False
    5·2 answers
  • Which resource is a flammable gas that occurs naturally underground
    11·1 answer
  • A group of students investigated the effect of soaking small onion bulbs in different concentrations
    7·2 answers
  • What are called micro organisms​
    5·2 answers
  • Why are chromosomes arranged in homologous pairs in meiosis
    9·1 answer
  • Summarize the results of your experiments.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!