1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Kipish [7]
3 years ago
5

Can you make money as a teenager?What are your opinions

Law
2 answers:
Alisiya [41]3 years ago
6 0

Answer:

It depends.

Explanation:

In my state you can apply at age 14 for a work permit to work at a select few stores, but only for a limited number of hours.

If youre younger than that or if you dont want to work you could:

-Take art commissions

-Create a shop on etsy selling crafts/slime

-Mow lawns, rake leaves, shovel snow

-get the proper training and become a babysitter

Sunny_sXe [5.5K]3 years ago
5 0

Answer:

in some states you have to be 14, 15 or 16 to work. But at gas stations or places that sell cigarettes and alcohol you have to be 18 so if you are a teenager you cannot work at this place. I will be 17 in June and I live in Florida so I got a job at Checkers a few days ago because they're hiring age is 16 and in Florida you have to be 14 and during school you have to have a work permit. those are just for public but there is not a certain age for when you go around and mowing people's yards, shoveling driveways, raking leaves etc

Explanation:

hope this helps and have a good day :-)

You might be interested in
The two-dimensional crime-scene images produced by still-life photography are ____.
torisob [31]

Group of answer choices.

A. being replaced by videographers.

B. being replaced by crime-scene reconstruction animation.

C. being replaced by security and surveillance cameras.

D. responsible to provide only crucial photographs of the crime scene.

Answer:

A. being replaced by videographers.

Explanation:

Forensic investigation can be defined as a field in criminology that deals with the gathering and analysis of all physical evidences related with a crime, so as to determine the facts and reach a conclusion on the victim and suspect. There are various techniques and software applications or programs used for obtaining and gathering data (informations) about a crime such as ProDiscover Forensic, CAINE, iLook, Sleuth Kit, identiKIT, etc.

In Forensics, the two-dimensional crime-scene images produced by still-life photography are now being replaced by videographers using modern technologies and techniques.

Videographer refers to an individual who is a professional or expert in the production of video-based clips through the use of a video camera. With this technology, forensic investigator are able to gather and analyze crime-scene footages using three-dimensional images or clips obtained from videographers.

8 0
3 years ago
Nora is a criminology student. she is tasked with explaining how society responds to an increase in crime. what theory is nora m
alexandr1967 [171]
A is the answer social pathology
6 0
2 years ago
Do you believe that the law is too restrictive or not restrictive enough? <br>​
Nadya [2.5K]

Answer:

too restrictive, they have way to much power and control over us nowadays... this is not the land of the free anymore

Explanation:

6 0
2 years ago
Read 2 more answers
How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
andreyandreev [35.5K]

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.

7 0
3 years ago
What is one major goal of U.S economic foreign policy?
____ [38]
One major goal of the US Economic Foreign Policy was to create trade agreements! :)
4 0
3 years ago
Other questions:
  • Why does Hamilton say that "all men of sense will agree in the necessity of an energetic executive," and that "the ingredients w
    8·1 answer
  • What was the first amendment
    8·2 answers
  • Decided during the Constitutional Convention of 1787, this accommodation onrepresentation in the proposed US House of Representa
    6·1 answer
  • Under the Driver Responsibility Program, what is the surcharge for a driver's first conviction of
    8·2 answers
  • Knock knock?
    7·2 answers
  • Match the vocab with the right definition. SOMEONE PLEASE HELP!!!!!!!!
    12·1 answer
  • What is the stair tool in investigation​
    8·1 answer
  • What have some departments done to eliminate unethical conduct by it's officers
    10·1 answer
  • Which of the following is an example of arson?
    13·1 answer
  • Trial courts in the federal judicial system are called.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!