1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
LUCKY_DIMON [66]
3 years ago
10

How are a coconut seed and a watermelon seed most alike?

Biology
1 answer:
aleksklad [387]3 years ago
5 0

Both coconut and watermelon are angiospermic species. In angiosperms ovary after fertilization becomes fruit and ovules become seed. Biologically seed of coconut and seed of watermelon seed has the same property only differ in size. Both are viable seeds and after germination they produce seedling and seedling grows into adult  plant.  


You might be interested in
Yhe _______________ glands secrete chemicals called hormones directly into the bloodstream.
julia-pushkina [17]

The endocrine glands secrete chemicals called hormones directly into the bloodstream.

<h3>What is endocrine system glands?</h3>
  • The endocrine system has ductless glands called endocrine glands that produce hormones directly into the circulation.
  • The pineal gland, pituitary gland, pancreas, ovaries, testicles, thyroid, parathyroid, hypothalamus, and adrenal glands are among the primary endocrine glands.
  • A group of organs called glands make up your endocrine system.  These glands, which are distributed throughout your body, create and release hormones.
  • In order to coordinate numerous biological activities, hormones are chemicals that go through your blood and connect with your organs, skin, muscles, and other tissues.

Learn more about the endocrine system with the help of the given link:

brainly.com/question/3534540

#SPJ4

8 0
1 year ago
They are about twice the size of red blood cells and turn into a macrophage when they migrate out of the blood into the tissues.
soldi70 [24.7K]

Answer:

C. Monocytes

Explanation:

Monocytes are 10-24 micrometer in diameter as compared to red blood cells which are only 7-8 micrometer in diameter. Monocytes are one of the agranular leukocytes and transform into macrophages when they migrate from blood to tissues. Their function is to kill the pathogens and cellular debris by the process of phagocytosis.

6 0
3 years ago
Which statement correctly describes genetic diseases or disorders? If one inherits a gene for a specific disease, and the gene i
Dmitrij [34]
I would say A just because if your dad has a genetic disease and you mom does not have it you have about a 50 50 chance of having that disease in a perfect control that's assuming that its recessive and that your moms side does not present this disease   
that's how its always been taught to me

8 0
3 years ago
Read 2 more answers
How can invasive species alter an ecosystems food web?
Harlamova29_29 [7]

Invasive species can either replace an organism from the ecosystem food web or replace it.  

Explanation:

  • Invasive species are non-native species which can be animals, plants, micro-organisms, fish, etc. they are very much threatening to the native species and ecosystem food web.
  • Invasive species are spread by humans mostly, it happens unintentionally when people travel and all. Even climate change could be a reason for its spread.
  • So, it becomes threatening to native species because when you introduce it into a new ecosystem, it does not have a predator or control. It grows aggressively and takes over the resources for the native species.
4 0
3 years ago
A scientific theory is a statement that describes what scientists expect to happen every time under certain conditions true or f
MariettaO [177]
It's true. Good luck
7 0
3 years ago
Other questions:
  • I’m 1953, who developed the model shown below ?
    5·1 answer
  • If _______ is not present, the Krebs cycle and electron transport system will not function.
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A type of human being which has been found as fossils is Homo habilis. What part of the name is the same as modern
    12·1 answer
  • The organelles that produce proteins used within the cell are the _____.
    6·2 answers
  • In a mixture of hydrogen gas, oxygen gas, and nitrogen gas, the molecules with the greatest average speed are those of
    13·1 answer
  • Can you get water out your blood stream please help I’m scared
    8·1 answer
  • A student is looking through a microscope at some cells of an onion root tip. Many of these cells are undergoing division since
    14·1 answer
  • Thirteen different SSR loci are used by the FBI to perform DNA fingerprinting. If SNP loci were assayed instead to identify indi
    14·1 answer
  • Help me with answer number 4​
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!