1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ghella [55]
3 years ago
9

What is a dendrite? A. It is a cell that sends signals to the central nervous system based on sensory input. B. It is the part o

f a neuron that carries information to the cell body. C. It is the part of the neuron that carries information away from the cell body. D. It is a cell that sends signals to the body to move.
Will mark brainlest for quick and correct answer
Biology
2 answers:
leva [86]3 years ago
7 0

Answer:

D

Explanation:

it D

joja [24]3 years ago
6 0

Answer:

I am pretty sure it's D.

Explanation:

a short branched extension of a nerve cell, along which impulses received from other cells at synapses are transmitted to the cell body.

You might be interested in
Most animal cells exhibit anchorage dependence, which means that in order to divide, Most animal cells exhibit anchorage depende
Anvisha [2.4K]

Explanation:

cells must be attached to a substrate or extracellular matrix of a tissue.

5 0
2 years ago
Scientists have worked on the structure of DNA and one of their revelations is the antiparallel arrangement of DNA strands. Whic
Lynna [10]
According to my observations the best answer is the option C.<span>The DNA strands are so arranged that you can never have two 5' or 3' at one end.
</span><span>As,they are anti-parallel and for that reason, one strand goes 5'-3' and the other goes 3'-5' respectively.
I hope its helpful.

</span>
3 0
2 years ago
Determine tRNA anticodons<br> UACCUGUUAAGCUACAAAAUU
Pavel [41]

Answer:

i dont know sorry , Gooqle it

7 0
2 years ago
25 On Graph 3 below create a bar graph of the data in Table 3 Table 3: Average rainfall in Willamette Valley Month Jan. Feb. Mar
belka [17]

Answer:

As 2020 continues, it has become increasingly easy to believe that the institutions of American democracy are breaking down. The president of the United States, despite having lost the presidential election, refuses to concede. Congress, which currently boasts a 21% job approval rating, has consistently demonstrated an inability to pass legislation supported by a majority of Americans. A third of the Supreme Court, an institution with tremendous power over American civil rights, consists of appointees by a president who lost the popular vote.

3 0
3 years ago
Which gas bubbles are being collected?
bija089 [108]

Answer:

I think it's the first option

7 0
2 years ago
Other questions:
  • Why doesn't asexual reproduction result in variation among offspring and parents?
    9·2 answers
  • If Earth was like a hardboiled egg, which part of Earth would the egg white represent?
    13·2 answers
  • A key should be parallel. An example of parallel choices is _____. A. animal can fly; AA. animal can't fly A. animal has 4 legs;
    15·2 answers
  • About how much of an organism is water <br> a) 25% <br> b)50% <br> c)70% <br> d)5%
    7·2 answers
  • Question 20 (1 point)<br> Phototransduction is the process:
    13·1 answer
  • What a the difference between microfilaments and microtubules?
    10·1 answer
  • How is RNA different from DNA?
    11·2 answers
  • How would you treat the bee stings​
    15·1 answer
  • Can someone help me on this plz? Thanks!
    9·2 answers
  • The cell membrane determines what is permitted to enter or exit a cell. What is the term used to describe this property
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!