1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
andrew-mc [135]
3 years ago
7

3) Scientists who have examined the fossil record have noted that some species have changed very little over long

Biology
1 answer:
d1i1m1o1n [39]3 years ago
7 0

Answer:

The correct answer is option A) "the environment that they lived in remained the same, and they were well-adapted to it".

Explanation:

One of the basis of evolution is that species that face new environmental conditions tend to develop new traits to survive. The opposite applies to species that have lived in constant environmental conditions, these species are usually well-adapted and have changed very little over long periods of geologic time. Some species of tortoises are examples of animals that had changed very little in their evolutionary history. The hard shells of tortoises is an ancient adaptation that help them to survive in constant environmental conditions.

You might be interested in
Scientists base many of their investigations on questions that test accepted theories. Which outcome of an investigation would c
Fynjy0 [20]

When you expect something, but get something else, you have a reason big enough to ask new questions and start a new investigation.


Example:


If you create a tree by artificially breeding different species, and then plant it with certain expectations in width, size, bark width, leaf shape, etc. and things go differently, a new investigation might begin with a whole new load of questions.


Answer:


\boxed{\bf~The~answer~is~most~likely~A.}



Hope it helped,


Happy homewok/ study/ exam!

4 0
3 years ago
Read 2 more answers
Scientists studying transcription in yeast (Saccharomyces cerevisiae) created an experimental strain that
Ray Of Light [21]

Answer:

Explanation:

Hello!

The scientist created an experimental strain that produces a modified RNA polymerase with a single amino acid substitution. This mutation is supposed to change the elongation rate of the mRNA during transcription.

The dependent or response variable, is the one the researchers are interested in, meaning, are the characteristics that the researcher will pay attention to and measure during the experiment.

In this example, the researcher is interested in testing the max elongation rate during transcription, which is the dependent variable of this experiment.

In the second part of the experiment, both strains of yeast, wilds, and experimental, where exposed to 40ug/mL solution of amanitin and recorded the maximum elongation rate of the RNA. This is naturally to test the effects of amanitin over the elongation rate of the mRNA in both strains.

The control group is a set of experimental units that are exposed to the same conditions as the experimental groups, with the exception that they receive no treatment (or they receive a "no effective" treatment often called a placebo). The purpose of a control group is to know the natural response of the experimental units to a treatment-free environment, this way when comparing both groups, the researcher will be able to observe the differences or changes due to the applied treatments.

In the second experiment, there are missing two control groups, one made of the wild strain and the other made of the experimental strain, exposed to the same conditions as the treated strains.

I hope this helps!

8 0
4 years ago
1. Why does sand settle to the bottom of a jar<br> faster than mud does?<br> 2. What is sediment?
Marysya12 [62]

1. Sand particles are too big to dissolve so their density sinks them

2. Sediment is a naturally occurring material that is broken down by processes of weathering and erosion, and is subsequently transported by the action of wind, water, or ice or by the force of gravity acting on the particles.

4 0
3 years ago
Two lakes have the same number of species. most of the fish in lake 1 are of a single species, with a few individuals each for t
JulsSmile [24]

Answer:lake 2

Explanation:

6 0
3 years ago
What are the long-termand short-term<br> effects of stress on the body, brain, andbehavior?
IgorLugansk [536]

Answer:

The short term effects of stress include pain, nausea, change in appetite, heartburn, constipation, and in some cases, diarrhea.

Long term effect of stress on the body and behavior include changes in one's eating habits and chronic pain. Another long-term effect of stress is acid flux.

Asides having negative effect on the body and behavior, stress can also have some negative effect on the brain such as increasing the risk of developing mental illness, killing of the cells in the brain, brain shrink, and it can hurt one's memory.

Explanation:

4 0
4 years ago
Other questions:
  • What is a hominid? I've looked everywhere and i cant find it.
    9·1 answer
  • When exercising outside on an extremely warm day, the client can feel his heart pounding very rapidly. Thinking in terms of the
    12·1 answer
  • Targeted gene knockouts involve the deletion or disruption of a given gene. What method might be effectively used to knock out a
    12·1 answer
  • The marine biomes have a huge impact on climate for____ Biomes
    6·1 answer
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • . Oleander is a very hardy plant that can survive in a wide
    7·1 answer
  • Elaborate on the disease Syphilis. Please and thank you
    13·1 answer
  • Which nucleotide base pairing would occur between molecules of DNA and
    15·1 answer
  • PLEASE HELP ME I CANT FAIL FINALS THIS YEAR<br> - state if true or false
    5·1 answer
  • The study of the cells in gastric pits is an example of.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!