1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
strojnjashka [21]
3 years ago
5

what are the morphological chemical function and similarities different between lysosomes and peroxisome​

Biology
1 answer:
bearhunter [10]3 years ago
5 0

Answer/explanation:

Differences: lysosomes have digestive enzymes (hydrolases) that break substances to be digested into small molecules; peroxisomes contain enzymes that degrade mainly long-chained fatty acids and amino acids and that inactivate toxic agents including ethanol; within peroxisomes there is the enzyme catalase, responsibal

You might be interested in
Organelles that are surrounded by two membranes and contain DNA are the
Snezhnost [94]

Answer:

C

Explanation:

The nucleus contains most of the dna and the mitochondria contains a small amount

3 0
3 years ago
The unpaired cartilage of the larynx that is made of elastic cartilage and bends when you swallow is called the
trasher [3.6K]
Epiglottis

The epiglotis is what allows you to swallow food without inhaling it.  It acts as a gateway between the digestive and respiratory systems
5 0
3 years ago
The nervous system releases neurotransmitters into synapses. in contrast, the endocrine system releases _______ into the bloodst
natulia [17]
Hormones

The endocrine system includes various glands in the body that are responsible for secreting hormones into the bloodstream. Hormones are chemical substances produced by the body that regulate certain functions of cells and organs. Hormones can regulate sleep, sex, growth, stress, huger, metabolism, etc. 
4 0
3 years ago
An organism with 24 chromosomes in each body cell will produce sex cells with __________ chromosomes.
Alik [6]
<span>The organism will produce 12 chromosomes (A).

Sex cells are the products of meiosis. Daughter cells of meiosis contain half the number of chromosomes of the parent cell. So if the parent cell has 24 chromosomes, then the sex cell would have <em>12 chromosomes</em>.</span>
3 0
3 years ago
Read 2 more answers
Who is credited with the theory of evolution by natural selection?
professor190 [17]

Answer:

D

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is a hypothesis?
    13·1 answer
  • What is speciation?
    7·2 answers
  • What contribution did Jonas Salk make to science in the 1950s?
    7·2 answers
  • Carbohydrates, lipids, and proteins are types of carbon compounds that are broken down to produce
    11·1 answer
  • T or F. The total number of deer, bears, hawks, and mice in a forest forms a population for that area.
    5·1 answer
  • Which of the following is not a step of Natural Selection?
    14·1 answer
  • Please help!!!<br><br><br><br><br><br> need this asap!<br><br><br><br><br> due today pls!!
    12·1 answer
  • Humans are not dependent upon abiotic parts of the environment. True or false?
    5·1 answer
  • Select the correct answer. in cellular respiration, where do the high-energy electrons that move through the electron transport
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!