1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nikdorinn [45]
3 years ago
13

What does competition mean and how might you see competition in an ecosystem?

Biology
1 answer:
allochka39001 [22]3 years ago
3 0

Answer:

Ecological competition occurs when living organisms, including animals, plants, bacteria and fungi, need the same limited resources to thrive in their shared environment. An ecosystem could collapse if several species needed the same scarce resources to complete their life cycle. Competition will occur between organisms in an ecosystem when their niches overlap, they both try to use the same resource and the resource is in short supply. Animals compete for food, water and space to live. Plants compete for light, water, minerals and root space.

Please Mark BRAINLIEST

You might be interested in
3. What makes a sedimentary rock a clastic rock
mote1985 [20]

<em>Answer</em>

<em></em>

<em>Clastic sedimentary rocks are made up of pieces  of pre-existing rocks. Pieces of rock are loosened by weathering, then transported to some basin or depression where sediment is trapped. If the sediment is buried deeply, it becomes compacted and cemented, forming sedimentary rock</em>

<em></em>

<em>Hope this help's you</em>

4 0
3 years ago
How does nuclear power compare to coal, oil, and natural gas?
Lena [83]

Explanation:

Nuclear Has The Highest Capacity Factor

That's about 1.5 to 2 times more as natural gas and coal units, and 2.5 to 3.5 times more reliable than wind and solar plants.

4 0
3 years ago
What type of relationship MOST LIKELY exists between the birds and the elephant?
sladkih [1.3K]
Mutualism because both animals benefit. The Elephant gets relived from the parasites that are on it and the bird gets food.
8 0
3 years ago
Lack of ______ has been linked to increased risk for autoimmune diseases. zinc iron vitamin C vitamin D
Eva8 [605]
Lack of vitamin D has been linked to increased risk for autoimmune diseases.
Hope that helped you.
5 0
3 years ago
Sensory nerve meaning<br>​
andrezito [222]

Answer:

it is nerve that carries sensory information towards CNS (centeral nerve system)

5 0
3 years ago
Other questions:
  • The skin of an animal should be examined for
    8·1 answer
  • What is holozoic mode of nutrition?How the food is simplified in the process of nutrition?
    15·1 answer
  • Starlings produce an average of five eggs in each clutch. if there are more than five, the parents cannot adequately feed the yo
    15·1 answer
  • Cold case files recently began re-investigating an old murder case. The murder took place in the park; a young man, James, was h
    12·2 answers
  • Which of the following refers to a germicide that can kill vegetative cells and certain enveloped viruses but not endospores?
    11·1 answer
  • When the left ventricle contracts, blood flows to the?
    6·2 answers
  • 16) Cells that elongate their cell walls prior to septation and septate in parallel planes will form
    9·1 answer
  • Place the steps shown below in the correct order.
    7·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Match the answer with the statement about promoters and enhancers. Group of answer choices Responsible for regulating translatio
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!