1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zubka84 [21]
3 years ago
6

What functions does a cell need to perform to survive? ​

Biology
1 answer:
Dafna11 [192]3 years ago
7 0
Cell membrane so you can think outside the box
You might be interested in
A _____ _______ sends an impulse to a muscle or gland, enabling it to respond.
hram777 [196]
Hi!

A nerval impulse sends an impulse to a muscle or gland, enabling it to respond.

Hope this helps! Good luck!
5 0
3 years ago
What are Two Specialized Tissues/Cells Involved With the Respiratory System
olga2289 [7]

Answer:

cilia cells, goblet cells

Explanation:

6 0
3 years ago
Compare the sexual and asexual reproduction methods in plants.
oksian1 [2.3K]
Asexual reproduction produces individuals that are genetically identical to the parent plant. The methods of asexual reproduction include: budding, grafting and cutting.
Sexual reproduction in plants produces individuals that only share some characteristics with the parents, but are not genetically the same. This is done primarily through pollination and fertilization.
5 0
3 years ago
Nick hypothesizes that wax has a higher melting point than chocolate. How can Nick test his hypothesis?
Ann [662]
B because that would be the equal choice
4 0
3 years ago
Read 2 more answers
The LPN/LVN carries out the teaching plan for a client undergoes nasal surgery. The LPN/LVN instructs the client not to blow the
11111nata11111 [884]

Answer:

Answer is option (3).

"Blowing your nose may cause bruising and edema."

Explanation:

Nasal surgeries like septoplasty, rhinoplasty, sinus surgery, etc are usually performed to improve breathing, repair nasal injuries, correct deformities , change the size or shape of the nose, correct sinus problems, etc.

After the surgery, the patient must follow certain instructions for at least 10 days. The instructions are;

  • Avoid strenuous activity for at least two weeks as it may cause bleeding or increase swelling in the operated area.
  • Avoid nose blowing after surgery as it may cause bleeding and spreading of infection into the eye. When the patient blows the nose after nasal surgery, the sinus pressure increases and results in increased pressure on the operative site which may cause bruising and edema. But it does not increase intracranial pressure or cause a fracture or decrease oxygen availability.
  • Apply nasal saline sprays on each nostril frequently as it keeps the nose clean and clears all debris (dried blood) and maintains moisture in the nose. Also, the clearing of nasal passage results in increased oxygenation.
  • Use nasal decongestants to reduce the swelling in the nose.
4 0
3 years ago
Other questions:
  • Multicellular colonies of plant cells adhere to each other primarily by ________
    6·1 answer
  • Please help me please!!!!!!!
    12·1 answer
  • What are the two active sites or domains on a repressor protein?
    8·1 answer
  • Homozygous dominant: Both inherited alleles are _________.
    11·1 answer
  • How many cells are there in the human body and how many microorganisms are there in a human body?
    13·2 answers
  • Explain why chromosomes, not individual genes,<br> assort independently.
    14·1 answer
  • Which of the following is true about jails?
    10·1 answer
  • The process of reproductive cloning begins by
    9·1 answer
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
  • 8. PART B: Which synonym would best maintain the
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!