1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stella [2.4K]
3 years ago
10

If the lithosphere is resting on the asthenosphere and you put a lot of

Biology
1 answer:
statuscvo [17]3 years ago
7 0

Answer:

Explanation:

Can you think of a solid that can flow?

You use one twice a day! Toothpaste is a solid that can flow. Is the asthenosphere made of toothpaste? Only if the

toothpaste is ultramafic in composition, and then it would only be able to flow if it were really, really hot. Still the

toothpaste analogy gives you a good image of how the asthenosphere might behave if you squeezed it!

Lithosphere

The lithosphere is composed of both the crust and the portion of the upper mantle that behaves as a brittle, rigid

solid. The lithosphere is the outermost mechanical layer, which behaves as a brittle, rigid solid. The lithosphere is

about 100 kilometers thick. How are crust and lithosphere different from each other?

You might be interested in
Why are microdeletions and microinsertions difficult to diagnosis using karyotyping?
Harman [31]
Because only the chromosomes can be seen in a karyotype, and microdeletions or insertions are mutations at the molecular level, it is virtually impossible to detect such mutations at the chromosomal level. 
8 0
3 years ago
Read 2 more answers
What's an Environmental Impact Statement (EIS)?
statuscvo [17]

Answer:

The environmental impact statement (EIS) is a government document that outlines the impact of a proposed project on its surrounding environment.

Hope this helps.

3 0
3 years ago
What type of vegetation is not frequently found in the tundra?
Rudik [331]
The vegetation of the tundra is composed of shrubs, grasses, mosses, lichens. Tree vegetation is very rare because of low temperature and short growing season.
3 0
3 years ago
Read 2 more answers
What is the difference between type A and type B blood?
dangina [55]
It is very easy and simple difference that is antigens and antibodies .
it can be different due to donor and recipient also .
A type blood having antigens
whereas B type blood having nil.

B type blood having antibodies
whereas A type blood having nil.


4 0
3 years ago
Where is the carbon taken in by plants during photosynthesis stored
Irina18 [472]

Answer:

Leaves, stem, and roots

6 0
3 years ago
Other questions:
  • Which of the following definitions is the correct description of symbiosis
    6·2 answers
  • Morphine is considered a(n) ________ drug because it decreases pain.
    6·2 answers
  • PLEASE HELP ME!!
    12·1 answer
  • David sustained a complete avulsion of his hamstring tendons from their origin on the ischial tuberosity. what classes of lever
    13·1 answer
  • Please Help Me (Science)
    13·1 answer
  • Multicellular animals have levels of organization. What characteristics of cells makes this possible? Please answer this to the
    8·1 answer
  • LDL (low-density lipoprotein) contains
    15·1 answer
  • How can we use systems thinking to create sustainable practices for now and in the future?
    8·1 answer
  • 2Ba(OH)2<br><br> Ba = <br><br> O = <br><br> H =
    9·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!