1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nady [450]
3 years ago
6

As Earth revolves around the Sun, the number of daylight hours varies from place to place. In which location would the number of

daylight hours remain constant?
( North Pole, Equator, Anartica, Prime Meridian)
Biology
1 answer:
frozen [14]3 years ago
7 0

Answer:

i think its the Equator im not that sure

You might be interested in
What is condensation
RUDIKE [14]

Condensation is the phase change from gas to liquid.  You can see condensation in the real world if you have a very cold drink.  A bottle of water filled with ice will attract water vapor from the air, and it will condensate around the bottle because the temperature is lower, which facilitates the phase change.  The outside of the bottle will contain a bunch of water droplets.

Hope this helps!!

3 0
3 years ago
Read 2 more answers
What is the difference between code, codon, and anticodon?
NeX [460]
The codon is a set of 3 nucleotides that can be read to convey a message in your DNA. It can be a code saying to "start" the process of protein synthesis, or "stop" it, or to encode for an amino acid - the building blocks of proteins. 
<span>The DNA is read, and proteins are made by DNA Polymerase (simple version here, it is more complicated, but this is the gist of it) travelling down the DNA. As it travels, it reads the nucleotides and builds a chain of amino acids, that corresponds to the information gleaned from the DNA. </span>
<span>So, the codon is only on one side of the DNA, and there are 2 sides. In order to be able to keep the DNA safe, and package it well (and loads of other reasons ) there is a complimentary strand. The nucleotides that make up DNA are A, T, C, and G. A links to T and C to G, and vice versa. </span>
So if your DNA strand's codons read "AAG AGG TCA"
Then the complimentary strand will read "TTC TCC AGT" the three codons on the complimentary strand ARE THE ANTICODONS of the codons on the strand being read (aka "expressed").
<span>So a codon and an anti codon are made of the same things, it just is a matter of which is being actively expressed. Now, this gets insanely complicated when you learn more about reading frames! Not only are there those codons, but if you shift and start reading the "code" either one nucleotide earlier or later, it completely changes the message.</span>
7 0
2 years ago
Freckles are a dominant trait in humans. Both of the girls have the genotype FF for freckles. If either one marries a man with n
sweet [91]

The answer is actually 100%

5 0
2 years ago
because ideas about evolution by natural selection have never been proven false what term can be used to describe evolution by n
Tanya [424]
The term that can be used to describe evolution by natural selection is SCIENTIFIC THEORY.

Theory means "the best explanation so far."

Scientific theory is a work in progress. It is a well-substantiated explanation of some aspect of the natural world that is acquired through the scientific method, and repeatedly confirmed through observation and experimentation.
8 0
3 years ago
Matings between individuals from the two populations of Rhagoletis produce hybrid flies that appear to be healthy and have norma
Mama L [17]
<h2>The correct answer is : C.</h2>

Explanation:

  • According to the question, mating between two populations of Rhagoletis produce hybrid flies.
  • This means that the two population is present in the same habitat or locality, hence they are capable of coming in contact with each other and mate. Hence, the answer cannot be Habitat Isolation.
  • Mating produces hybrid flies. This is possible when the gametes (egg and sperm) of the two different populations are capable of capable of coming close to each other and undergoing fusion (fertilization). Hence, there is no Mechanical Isolation.
  • The zygote formed by the above fertilization is capable of developing into healthy hybrid flies with normal life span. Hence, Pre-zygotic Isolation is absent.
  • But the hybrid flies formed are sterile and not fertile, that is, they are incapable of producing viable gametes which can undergo fertilization and produce a new offspring.Therefore, the eggs laid by the hybrid flies hatch less often. Hence, there is existence of Reduced hybrid fertility.
8 0
3 years ago
Other questions:
  • Which of these phrases BEST describes atoms?
    9·1 answer
  • In cells, the production of proteins is handled by the ribosomes and endoplasmic reticulum, while the processing and packaging o
    12·2 answers
  • Particles of rock silt and sand carried in flowing water are called
    7·1 answer
  • 3. The change in temperature during summer is due to<br> *
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Materials and waste that are removed from a cell with the use of a vesicle is called ?
    10·2 answers
  • Which of the following describes how an animal welfare activist would feel about raising cows for food and leather?
    5·1 answer
  • What type of molecules are the potassium and sodium in the axon?
    15·1 answer
  • The process of __________ generates the oxygen that we breathe and the food that we eat. view available hint(s)for part a photos
    11·1 answer
  • Clearly explain why Marquis thinks that abortion is immoral. In particular, explain his analysis of what makes killing an adult
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!