1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Olenka [21]
3 years ago
6

Which of the following venation patterns is characteristic of monocot leaves

Biology
1 answer:
Lena [83]3 years ago
4 0

Answer:

Which of the following venation patterns is characteristic of monocot leaves

Monocot leaves have parallel venation as the vein runs in a straight line e.g zea maize leaf

Explanation:

You might be interested in
Why are there so many differences in the properties of peptides and proteins?
Volgvan
Protiens are very important and they are regarded beneficial 
The protiens and peptides differ in their size protiens are relatively small
There are soi many difference among both because
<span>Several amino acid sequences are possible for proteins and peptides
</span>As there are 20 amino acids and different folding structure
so correct option is A
hope it helps
4 0
3 years ago
According to this diagram, which number most closely represents the process of photosynthesis?
olchik [2.2K]

Answer:

Can you please put an image of the diagram

Explanation:

3 0
2 years ago
Read 2 more answers
When does cell differentiation occur? Question 1 options: when cells express the same gene when cells express different genes wh
serg [7]

Answer:

The answer is when the cell express different genes.

Explanation:

Cell differentiation is the process when a cell is changed from one cell type to an other and brings more complexity to the system. A cell before differentiation possess all the genes however their expression in turned off. When some external or internal factors trigger the gene expression it starts the cell differentiation. A multicellular organism undergoes several rounds of cell differentiation during its development. Although cell differentiation changes the size, shape and metabolic activity but the genetic makeup or DNA is never changed during cell differentiation.

5 0
3 years ago
Igneous rock classification is based on texture and ______.
Tems11 [23]
Answer:
-chemical composition...
:)
7 0
3 years ago
Copying genetic information from dna into rna is called __________; using the information contained in mrna to make a polypeptid
Ket [755]
Genetic information from DNA to RNA is called transcription which involves the enzyme RNA polymerase. The DNA is read from 3' to 5' in direction and produces an mRNA (messenger RNA) which contains the genetic data from the DNA. This mRNA strand is further processed in the nucleus (capping and adding a poly-A tail) before being transported to the cytoplasm. 

The information contained in mRNA is used to make a polypeptide chain is called translation. This involves the use of ribosomes in the cytoplasm which attach themselves to the mRNA strand then using tRNA (transfer RNA) to add amino acids to the elongating polypeptide depending on the codon in the mRNA.
8 0
3 years ago
Other questions:
  • In early spring, many wildflowers begin to grow, produce flowers, and release seeds. The leaves of the wildflowers make food bef
    9·1 answer
  • Our atmosphere is composed of several gases. The name of the gas we breathe, O2, is A) dioxide. B) dioxygen. C) oxide. D) oxygen
    11·2 answers
  • Which of the following is NOT true of phospholipid bilayers?
    15·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • During the production of fertilizer, NH(am) reacts with H3PO4(aq). For this chemical reaction, match each description with the a
    12·2 answers
  • Which is the best description of civil liberties?
    6·2 answers
  • The cell cycle an mitosis
    9·2 answers
  • *PLEASE ANSWER FAST!
    15·2 answers
  • Which of the following parent combinations could result in a type o blooded child?​
    13·2 answers
  • Are lysosomes in plants cells? Are they found in there or not? Will be marking Brainliest!
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!