B) The enzyme has active sites where the substrate binds with the enzyme to form a complex. When the substrate binds to the active site, an induced fit is formed where the enzyme changes its shape in order to better serve the substrate and lower the activation energy of the reaction
The pancreatic juice is secreted by the pancreas. This pancreatic juice is secreted into the first part of the small intestine known as the duodenum. This pancreatic juice is rich in various enzymes that help in the digestion of various food components (carbohydrates, fats, and proteins). Besides being rich in enzymes, it is also rich in bicarbonate content. The bicarbonate works to neutralize the acidic chyme. This helps the enzymes to function and carry out digestion properly. If the pancreas fails to produce bicarbonate, then the function of enzymes will be altered, and the acidic chyme (coming from the stomach) will damage the small intestine walls.
my answer would be the 3rd one
my bad if i'm wrong
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T
