1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anna007 [38]
3 years ago
6

Which of the following is NOT part of the cell theory? Group of answer choices

Biology
1 answer:
natta225 [31]3 years ago
8 0

where are the answers????

You might be interested in
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Write down 5 pros and 5 cons of biotechnology​
Lera25 [3.4K]

The Pros of Biotechnology-

1. It can improve health and reduce hunger simultaneously.

2. It creates flexibility within the food chain.

3. It offers medical advancement opportunities.

4. It allows us to preserve resources.

5. It helps us minimize or eliminate waste products.

6. It can reduce infectious disease rates

The Cons of Biotechnology-

1. It creates an all-or-nothing approach.

2. It is a field of research with many unknowns.

3. It could ruin croplands.

4. It turns human life into a commodity.

5. It can be used for destruction.

Hope it helps

4 0
3 years ago
In 3-5 sentences and in your own words, describe why a green banana will start to ripen and turn yellow much more quickly if a b
Ulleksa [173]

Answer:

Hormones communicate between plants and signal to ripen further  the release of ethylene helps in this ripening as well.

Explanation:

  • When a green banana is placed closely to a brown banana it will ripen more quickly and would turn yellow  because the brown banana releases a chemical called ethylene.
  • Ethylene is gaseous is nature and is thus, able to affect plants that lie close to it and this is the reason why ethylene is known as a fruit ripening hormone.
  • The amount of ethylene increases in fruits as the fruit further ripens and hence, when placed next to a brown banana the green banana will ripen more quickly and turn yellow.

6 0
3 years ago
Which adaptation would be most helpful to animals in a desert?
dybincka [34]

Answer:

Desert animals must cope with two things; temperature extremes and lack of water.

Explanation:

Therefore, most adaptations in desert animals, while they may seem bizarre, serve the purpose of helping that animal cope with these two problems. Both are important. Water is necessary for life, and balancing the water budget is essential for desert animals.

5 0
3 years ago
Read 2 more answers
Does salt move inside or outside
Firdavs [7]
Well it depends cause when you sweat salt escapes the body
4 0
3 years ago
Other questions:
  • If an egg was 20% of a birds body weight how much does it weigh if the bird was 10 pounds
    11·1 answer
  • . Determine the sequence of bases in mRNA if the original DNA base sequence is TAGGCTAA
    6·1 answer
  • What advances have happened that allow us to look inside the living human brain?
    9·1 answer
  • If a product is recycled, is anything lost in terms of material or energy?
    7·2 answers
  • An increase in the amount of which atmospheric gas is thought to cause global climate warming?
    5·1 answer
  • In general, geographical isolation occurs when
    14·1 answer
  • Question 20 (1 point)<br> Phototransduction is the process:
    13·1 answer
  • Bacteria multiply by division. One bacterium becomes two. Then two divide into four, the four divide into eight, and so on. For
    9·1 answer
  • An alpha-2-agonist that provides excellent sedation, muscle relaxation, and analgesia is
    9·1 answer
  • Hugh is writing an article for an ecological magazine. Help him complete the sentences
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!