1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Keith_Richards [23]
3 years ago
14

Compare and contrast the adaptations of the toucan and monstera plants of the rainforest​

Biology
1 answer:
Virty [35]3 years ago
6 0

Answer:

The Toucan has a long, narrow beak that allows it to reach fruit that is hard to reach for other birds. Plants, like the Monstera Plant, in the rainforest have long, grooved leaves to drop water to the forest

floor. The excessive water that falls in the rainforest could lead to mold, so the leaves adapted to

have “drip tips” that allow the water to run off of the leaves.

You might be interested in
Using the Gizmo, create a fruit fly with the correct genotype. Explain how you did it
ladessa [460]

Answer:

I did 4 crossovers and followed the genotype. That's how I did it.

Explanation:

6 0
3 years ago
Select the correct answer.
natali 33 [55]
The best answer would probably be observation because a hypothesis and theory is not always reliable. an observation describes what IS happening during the experiment.
4 0
3 years ago
Read 2 more answers
In a forest ecosystem, clover is eaten by deer, which are eaten by wolves. If the population of clover suddenly decreased:
Natasha2012 [34]

The population of scavengers would increase.  

hope it helps you

3 0
3 years ago
Chromium (Cr) can combine with chlorine (Cl) to form chromium chloride (CrCl3).
Viktor [21]
The right answer is going to be D


5 0
3 years ago
PLEASE HELP WHAT IS THIS BUG
Marysya12 [62]

Answer:

i dont know

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • How are food chains and food webs related
    10·1 answer
  • The members of a society? A. Belong to at least two species B. Belong to the same species and interact closely with each other C
    8·1 answer
  • Pieces of DNA left at a crime scene can be multiplied by using
    14·1 answer
  • The probability of a ___________ channel being open is controlled by the membrane potential.
    8·1 answer
  • Henri Becquerel and the Curies worked with uranium, radium, and polonium, all of which give off _____. sunlight radiation elemen
    5·1 answer
  • What kind's of solution's might address the problems with dying coral reefs? Explain your answer.
    10·1 answer
  • Nuclear energy is a useful source of power but has disadvantages. What is a disadvantage of nuclear energy?
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What science and engineering practices have helped detect and predict hurricane formation?
    14·1 answer
  • What does the image refer to?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!