1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sergeeva-Olga [200]
2 years ago
6

6. Calculate the kinetic energy of a baseball thrown by Aroldis Chapman, who holds the world record for fastest pitch. The baseb

all
has a mass of 0.145 kg and velocity of 47.0 m/s.
a. 3.40J
b. 320 J
c. 6.82 J
d. 160J
Biology
1 answer:
GrogVix [38]2 years ago
5 0

Answer:

D

Explanation:

=122

You might be interested in
What type of mutation in nucleotide 4 would produce the same amino acid?
g100num [7]
Most likely a silent mutation. Silent mutations are mutations in DNA that do not have an observable effect on the organism's phenotype because the same amino acid is produced regardless of the change in the nucleotide sequence by the mutation.
8 0
3 years ago
Can someone help I don’t know
stellarik [79]

1. Female, white fur

2. Male, white fur

3. Male, white fur

4. Female, white fur

Q3.) 2 generations (parents and offspring)

8 0
2 years ago
What molecule in your body would be responsible for Gathering and attaching nucleotides​
Firlakuza [10]

Answer:

I would say Phosphate Groups.

Explanation:

Nucleotides are joined together by covalent bonds between the phosphate group of one nucleotide and the third carbon atom of the pentose sugar in the next nucleotide.

3 0
2 years ago
How was the clean air act of 1970 different from previous legislation aimed at reducing pollution?
Ede4ka [16]

Answer: B

Explanation:

I just did it

8 0
3 years ago
Which of the following statements are observations about the photo on the right? Check all that apply. Three boys are wearing gr
tia_tia [17]

Answer:

three boys

most of the children

the grass

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • Is leucoplast found in prokaryotic cells or eukaryotic cells or both
    5·1 answer
  • Which of the following can be inferred from the differences between the skulls of Australopithecus afarensis and Homo neaderthal
    15·2 answers
  • The polar head of a phospholipid is made of _______ molecules.
    9·1 answer
  • Label the components of the activation of a helper t cell by a dendritic cell.
    7·1 answer
  • In many cells the structure that controls the cell's activities is the
    5·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • Organic compounds ____________ (are/are not) only generated by living things.
    11·1 answer
  • Which is composed of amino acids and determines all the structures and functions of organisms?
    5·2 answers
  • The diagram below represents a marine food web and a process that can harm the human population. Each circle represents an organ
    12·1 answer
  • True or False: If a dominant allele is present, the recessive trait will not be expressed
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!