1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vlada-n [284]
3 years ago
9

Please help I need the answer ASAP

Biology
2 answers:
poizon [28]3 years ago
7 0

Answer:

I am guessing Cenozoic

Explanation:

I hope this helps

bagirrra123 [75]3 years ago
5 0

Explanation:

the answer is A. I'm sure of it

You might be interested in
How should the biological name of the giant water bug be written in binomial nomenclature?
monitta
Binomial Nomenclature is written using the genus name and its specific epithet. Originally, it was classified under genus Belostoma making its binomial name Belostoma sp. But after a taxonimic revision cited on 2006, the giant water bug was then classified under genus Lethocerus and specific epithet americanus making its binomial name now Lethocerus americanus or L. americanus.
5 0
4 years ago
The appendages of cockroaches and turtles are modified for creeping movements,but their internal structures are completely diffe
Digiron [165]
A convergent evolution is a phenomenon of independent evolution of similar traits in species that are in different lineages. These traits are called analogues structures. They are similar in form or function but were not present in the last common ancestor of those species. So, t<span>he appendages of cockroaches and turtles are analogues structures with the similar function - creeping movements, and they are the result of the convergent evolution.</span>
3 0
3 years ago
Which student correctly identified the outcome of meiosis?
laila [671]
The answer is C. Hahdhfhdjdhxhdhhjfhcufjtuf
8 0
2 years ago
Suppose a gene from a cow is introduced into a frog. This results in a ________ transgene.
Helen [10]

Answer:

Heterologous transgene.

Explanation:

Heterologous transgene can be defined as the expression of a gene from another animal into another. Such an animal that this gene is introduced to does not have such a gene in them naturally, this is done through a firm of DNA technology.

So when a gene from an animal such as a cow is put into another animal like the frog, the result is heterologous transgene.

8 0
3 years ago
Multiple alleles _____.
just olya [345]
I'd go with A. can interact to influence a trait, such as eye color
8 0
3 years ago
Other questions:
  • What is the relationship between the factors that makeup an ecosystem and biodiversity?
    12·1 answer
  • Is a fetus alive accoring to the 8 characteristics of life?
    14·1 answer
  • A man who is an achondroplastic dwarf with normal vision marries a color-blind woman of normal height. the man's father was six
    13·1 answer
  • What happen during reconstruction phase of wound healing ?
    10·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Mr. Ramirez, whose blood type is AB-, has been injured and requires a blood transfusion. Which blood type may be acceptable for
    13·1 answer
  • What are macronutrients?What are the 4 main macronutrients?​
    7·2 answers
  • The redundancy of the genetic code is a consequence of ______. View Available Hint(s) The redundancy of the genetic code is a co
    8·1 answer
  • A "code" for organisms genetic makeup or allele combinations; this is found in our DNA/chemicals. A.phenotype B.Genetics C.Genot
    11·1 answer
  • A 4kg object has a volume of 7.5ml calculate the density
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!