1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
liubo4ka [24]
3 years ago
9

A tertiary consumer, such as a red-tailed hawk, receives what percent of the energy fixed by primary producers in a typical fiel

d ecosystem?
Biology
2 answers:
myrzilka [38]3 years ago
8 0
Assuming a 10% trophic efficiency, the herbivore (primary consumer) will get 10% of the producer energy. Then, the second consumer that eat the herbivore will get 10% of the primary consumer energy, so it is 10%*10%= 1% of the primary producers.
Then, the t<span>ertiary consumer should get 0.1% of the primary producers' energy.</span>
Zinaida [17]3 years ago
4 0
Since only 10 percent of energy obtained in one trophic level is successfully passed to the next trophic level in the case of the tertiary consumer ( the organism that is in the third trophic level) the organism will obtain only 1 percent of the initial energy.
For example, a plant would obtain the energy from the radiation of the sun, 10% of that will be passed to a field mouse that eats the plant, and the 10% of the 10% or 1% of the initial energy would be obtained by the hawk.
You might be interested in
I WILL GIVE BRAINLIEST
zepelin [54]

Answer:

i cant do this i can only type

Explanation:

4 0
3 years ago
NEED HELP ASAP WILL GIVE BRAINLIEST THANK YOU
slamgirl [31]

Answer:

b

Explanation:

5 0
3 years ago
Read 2 more answers
What type of cell is shown below?<br> Plant cell,egg cell,eukaryotic cell,prokaryotic cells?
NikAS [45]

Answer:

bacteria cell I think I'm probably wrong

5 0
3 years ago
Read 2 more answers
In a short paragraph, identify five factors that are contributing to the Europeanization of culture and identity across the cont
Cerrena [4.2K]
Europeanizationefers to a number of related phenomena and patterns of change: The process in which a notionally non-European subject (be it a culture, a language, a city or a nation) adopts a number of European features (Westernization).
6 0
3 years ago
Read 2 more answers
The plaque (microbial biofilm) that forms between your teeth is a highly anaerobic (oxygen-free) environment, even though the mo
slavikrds [6]

Answer: The bacteria uses the oxygen present in the mouth.

Explanation:

The plaque that is formed in the teeth is a highly anaerobic bacteria but it can sustain in the environment rich in oxygen. The oxygen is used by the bacteria and there is a absence of oxygen in the teeth.

It is formed in between the teeth which needs oxygen to survive and if remains for tooth for a longer period of time then it began to grow without oxygen.

It basically uses the oxygen available in the mouth and makes the condition anaerobic.

8 0
3 years ago
Other questions:
  • A minimum of 100 years of isolation is required for two populations to accumulate enough differences to be considered different
    11·1 answer
  • When a neuron is at its resting state, what is the status of the charges on each side of the cell membrane?
    12·1 answer
  • Which characteristic of a geographic region
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Explain why components that are naturally found in air can be considered air pollution
    8·2 answers
  • The restriction enzyme bamhi recognizes the dna sequence ggatcc and always cuts between the two g nucleotides. how many bases lo
    9·1 answer
  • Why are some motors painted black?
    8·1 answer
  • A client is receiving an intravenous infusion of 1000 mL of normal saline with 40 mEq of potassium chloride. The care unit is mo
    14·1 answer
  • Which plant has largest pollen ​
    10·1 answer
  • What are some Characteristics of a ladybug before metamorphosis
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!