1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
RideAnS [48]
3 years ago
14

The opening and closing of _____________in your heart create the lub-dub sound and prevent the backflow of blood.

Biology
1 answer:
iVinArrow [24]3 years ago
4 0

Answer:

Heart valves or the closure of the mitral and tricuspid atrioventricular (AV) valves at the beginning of ventricular systole and the closure of the aortic valve and pulmonary valve at the end of ventricular systole.

Explanation:

The heart tone “lub,” or S1, is caused by the closure of the mitral and tricuspid atrioventricular (AV) valves at the beginning of ventricular systole.

The heart tone “dub,” or S2 ( a combination of A2 and P2), is caused by the closure of the aortic valve and pulmonary valve at the end of ventricular systole.

You might be interested in
If a stimulus to a neuron is great enough, ________ is reached and an action potential is generated.
Valentin [98]

Answer:

If a stimulus to a neuron is great enough, ___<u>t</u><u>h</u><u>r</u><u>e</u><u>s</u><u>h</u><u>o</u><u>l</u><u>d</u>_____ is reached and an action potential is generated.

3 0
3 years ago
Read 2 more answers
Where dose mass of a willow tree come from
MA_775_DIABLO [31]

Answer:

So where does the mass come from? The mass of a tree is primarily carbon. The carbon comes from carbon dioxide used during photosynthesis. During photosynthesis, plants convert the sun's energy into chemical energy which is captured within the bonds of carbon molecules built from atmospheric carbon dioxide and water.

Explanation:

Hope it helps! Correct me if I am wrong :>

Im sure about my answer :>

If you dont mind can you please mark me as brainlest?

3 0
3 years ago
How did lucy survive?​
Aleksandr-060686 [28]

Answer:

Which Lucy?

Explanation:

7 0
3 years ago
Read 2 more answers
Chemicals from sea slugs may be useful in:
Verdich [7]
Chemicals from sea slugs may be useful in <span>sewage treatment plants.
</span>The sewage treatment plants process includes <span> removing contaminants from wastewater, primarily from household sewage. </span>
The output of the sewage treatment process is treated wastewater that is safer for the environment.
4 0
3 years ago
Read 2 more answers
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Other questions:
  • Roan coat color in cattle develops through incomplete dominance of the gene for red color and its allele for white. what crossin
    7·1 answer
  • The diagonal arrow of a cladogram shows us that we are moving _________ in time.
    8·2 answers
  • What are requirements or recommendations for a healthy diabetic diet
    8·1 answer
  • Travels faster through a liquid than through a solid
    5·2 answers
  • This illustration shows a kind of animal that is a free living organism. What is the common name of the group that contains this
    8·2 answers
  • EXPLAIN how plants allow all organisms on Earth to survive? (3-4 reasons required)
    7·1 answer
  • Psychometric scores for anxiety, depression, negative self, somatization, and hostility were combined into a single Global Sever
    13·1 answer
  • A que altura debe moverse un costal de cemento de 50kg para asegurar que su energía potencial sea de 10,500 j?
    5·1 answer
  • The hypothalamus controls the posterior pituitary by way of __________.
    10·1 answer
  • Read about the life cycle of an apple tree, and think about the role apples play in reproduction. Describe how apples help apple
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!