Answer:
If a stimulus to a neuron is great enough, ___<u>t</u><u>h</u><u>r</u><u>e</u><u>s</u><u>h</u><u>o</u><u>l</u><u>d</u>_____ is reached and an action potential is generated.
Answer:
So where does the mass come from? The mass of a tree is primarily carbon. The carbon comes from carbon dioxide used during photosynthesis. During photosynthesis, plants convert the sun's energy into chemical energy which is captured within the bonds of carbon molecules built from atmospheric carbon dioxide and water.
Explanation:
Hope it helps! Correct me if I am wrong :>
Im sure about my answer :>
If you dont mind can you please mark me as brainlest?
Chemicals from sea slugs may be useful in <span>sewage treatment plants.
</span>The sewage treatment plants process includes <span> removing contaminants from wastewater, primarily from household sewage. </span>
The output of the sewage treatment process is treated wastewater that is safer for the environment.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.