1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alenkasestr [34]
3 years ago
6

During respirations, select all that apply.

Biology
1 answer:
Helen [10]3 years ago
5 0

Answer:

The correct answer will be option- B and C.

Explanation:

The cellular respiration is the process of forming energy molecules through oxidation of food. The cellular respiration takes place in four stages: glycolysis, link reaction, Krebs cycle and electron transport chain.

The glycolysis converts the glucose molecules to form two molecules of pyruvate and two ATP molecules but the total number of molecules formed in cellular respiration is between 36-38 ATP molecules. The electron flow takes place in the electron transport chain which helps in the generation of the proton motive force used to produce ATP molecules.

Thus, Option-B and C is the correct answer.

You might be interested in
Cameron is collecting data to determine the time of completion for each stage of germination in seeds. He is using bean seeds fo
mariarad [96]

Answer:

it is c: Taking observations at precise intervals

Explanation: I just took the test.

8 0
3 years ago
#4 plsss student's combined baking soda and vinegar to demonstrate a chemical reaction. what indicates that a chemical reaction
snow_tiger [21]

Answer:A

Explanation:it’s being change by a mixture of substances put together

7 0
3 years ago
Read 2 more answers
What is the role of activation energy in a chemical reaction
Snezhnost [94]
Activation energy is the amount of energy required to begin a chemical reaction.
5 0
3 years ago
Which of the following correctly shows a prairie food chain?
Ivenika [448]
The first one does.
5 0
2 years ago
Bisphosphoglyceric acid (BPG) is a byproduct of glycolysis released into the bloodstream when an animal's supply of oxygen is lo
deff fn [24]

Answer:

a. hemoglobin now binds more oxygen at low partial pressures than at high partial pressures.

Explanation:

I took regular Biology in 9th Grade, AP Chemistry in 10th Grade, AP Biology in 11th Grade, and DE (Dual Enrollment) Microbiology in 12th Grade. Currently majoring in Biology at the University of Michigan - Ann Arbor.

6 0
2 years ago
Other questions:
  • Diversity is an expression of the total number of organisms in a biological community.
    5·1 answer
  • What is a covalent bond?
    7·2 answers
  • You have three species A, B, and C. Assume that they form a monophyletic group
    10·1 answer
  • Which of these is a heterotroph?
    13·2 answers
  • SA nodal cells are unique in that they exhibit autorhythmicity, meaning they are capable of depolarizing and firing an action po
    8·1 answer
  • The largest number of individuals an area can support is referred to as
    6·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Organelles that are surrounded by two membranes and contain DNA are the
    14·1 answer
  • A scientist is trying to decide whether an organism is Prokaryotic/Eukaryotic. Which information would help make the decision?
    10·1 answer
  • in order to keep a resting membrane potential, the active transport of the sodium and potassium pump must function to keep:
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!