Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Difference between aquatic animals and terrestrial animal is
Because all living things are made of carbon in one way or another and we use nitrogen and water naturally.
Mitosis is the cell division used to replace the old cell.
This type of cell division is used when a cell needs to be replicated into exact copies of itself. The new cell (Two in number) is totally duplicate of the original one. The new two cells are called daughter cell while as original one is called mother cell.
