1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
den301095 [7]
3 years ago
7

Could somebody help me please this is my science test

Biology
1 answer:
Sauron [17]3 years ago
4 0

Answer: I do believe it is answer C, Smooth. Terribly sorry if this is wrong.

You might be interested in
What are the characteristics of the vertebrate's nervous systems?
Delicious77 [7]

Answer:

Vertebrates contain nervous system which is highly specialized organ.

Explanation:

The nervous system is the complex system in the vertebrate body which is composed of central nervous system that contain brain,spinal cord and peripheral nervous system which contain cranial nerve, spinal nerve,involuntary nerve etc.

The nervous system contain neurons that mainly transmit signal to the different parts of the body.

The peripheral nervous sytem contain somatic and visceral part.

The grey matter and white matter are the 2 areas in vertebrate nervous system.

6 0
3 years ago
Describe This plant cell has been sliced in help and you are looking into one of the halves. How would you describe the structur
Veseljchak [2.6K]
Plant cells are the basic unit of life in organisms of the kingdom Plantae. They are eukaryotic cells, which have a true nucleus along with specialized structures called organelles that carry out different functions.They also have a cell wall that provides structural support.
3 0
3 years ago
Explain how moving water can cause erosion. PLEASE HELP!!
mart [117]
Rainfall can cause erosion both when the rain hits the surface of the Earth, called splash erosion, and when raindrops accumulate and flow like small streams. Rivers can create a significant amount of erosion over time. They break up particles along the river bottom and carry them downstream. One example of river erosion is the Grand Canyon which was formed by the Colorado River. Ocean waves can cause the coastline to erode. The shear energy and force of the waves causes pieces of rock and coastline to break off changing the coastline over time. Large floods can cause erosion to happen very quickly acting like powerful rivers.
7 0
4 years ago
A plant developed a mineral deficiency after being treated with a fungicide. What is the most probable cause of the deficiency?
Musya8 [376]

Hey! How are you? My name is Maria, 19 years old. Yesterday broke up with a guy, looking for casual sex.

Write me here and I will give you my phone number - *pofsex.com*

My nickname - Lovely

6 0
3 years ago
Which property of matter is conserved in chemical reactions and shown by balanced equations?
kompoz [17]

Answer:

Density is conserved in chemical reactions and shown by balanced equations

5 0
3 years ago
Other questions:
  • What is the difference between prophase and prometaphase?
    14·1 answer
  • What is the energy brought by electron carriers to the<br> mitochondria used for?
    7·1 answer
  • (HELP ASAP, LAST QUESTION) What is the most likely evidence of an energy transformation taking place when a hotplate that has a
    9·2 answers
  • How does fibre help the body ?
    9·2 answers
  • In 1939, the use of DDT (a powerful synthetic chemical) as an insecticide was discovered. The United States adopted its widespre
    5·2 answers
  • ASAP test Monday <br><br>what do changes in PH due to an enzyme that reduce its activity??​
    9·1 answer
  • Question 13 of 20 :
    9·1 answer
  • TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
    11·1 answer
  • 2 Which part of the blood is liquid and made mostly of water?​
    5·1 answer
  • What causes the weather conditions using what we learned.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!