The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.
<h3>What is a sense DNA strand?</h3>
DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.
During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.
In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.
Learn more about transcription here:
brainly.com/question/1048150
Answer:
Process by which plants and some organisms use light energy to convert water and carbon dioxide into oxygen and sugar.
Explanation:
Answer:
blue whales migrating to mate and give birth
Explanation:
The Rocky Mountains formed 80 million to 55 million years ago during the Laramide orogeny, in which a number of plates began sliding underneath the North American plate. ... Since then, further tectonic activity and erosion by glaciers have sculpted the Rockies into dramatic peaks and valleys.
Most of the present physiographic regions of the Great Plains are a result of erosion in the last five million years. Widespread uplift to the west and in the Black Hills caused rivers draining these highlands to erode the landscape once again and the Great Plains were carved up.