1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Allisa [31]
3 years ago
12

Can anyone help me with this please?

Biology
2 answers:
Lerok [7]3 years ago
6 0

Answer:

The correct answer is A.

vesna_86 [32]3 years ago
3 0
The third one is not true
You might be interested in
Animal A and Animal B each have 95% of their DNA in common. Animal A and Animal C each have 50% of their DNA in common.
kramer

Answer:

I wanna say its the first answer but dont take my word for it.

Explanation:

8 0
4 years ago
Read 2 more answers
HELP ME PLEASE!!! Genetics, botany, zoology are all branches of what subject.
Mnenie [13.5K]
Genetics, botany, zoology are all branches of the subject biology. Biology<span> is a broad </span>subject<span> that deals with all these aspects of the life on Earth.
Solution: C: Biology
From the given option, the lizard is example of </span>organisms that is most likely 5 centimeters in size. Lizards are <span>group of squamate reptiles and contains over 6,000 species. 
Solution:D.lizard</span>
5 0
4 years ago
Read 2 more answers
Benign is to inactivate as malignant is to _____. a) shrinking b) active c) dormant d) cancerous
seropon [69]
B is the answer. my aunt has a malignant tumor and that means its active
8 0
4 years ago
Hat type of cells do not undergo mitosis?
djverab [1.8K]

Answer:

Neurons, cardiac muscle, Red/white blood cells, skeletal muscle, smooth muscle, sperm cells, egg cells

Explanation:

6 0
3 years ago
What is one use of glucose?
Alekssandra [29.7K]
B. to make cellulose in the cell walls
6 0
4 years ago
Other questions:
  • Non-avian reptiles can produce hyperosmotic urine using which structure?
    15·2 answers
  • How can scientists determine the absolute age of a rock sample?
    10·1 answer
  • What are the agonist and antagonist muscles of the wrist?
    15·1 answer
  • Which substance is the most acidic?
    9·2 answers
  • Which type of energy takes place during cellular respiration
    13·1 answer
  • Vitamin D-3 is synthesized in the skin in response to sun exposure. Question 5 options: a. True b. False
    12·2 answers
  • A population of rabbits lives in a grassy field that is lush and green in summer and covered in snow in winter. At the start of
    5·1 answer
  • What environmental conditions do goat need to grow?
    15·1 answer
  • What type of front is in this picture? please answer i will give you brainliest
    10·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!